transmembrane protein 38B (TMEM38B) - coding DNA reference sequence

(used for mutation description)

(last modified November 13, 2012)


This file was created to facilitate the description of sequence variants in the TMEM38B gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_032971.1, covering TMEM38B transcript NM_018112.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5016
                                             gccagggcgcacgcgc       c.-121

 .         .         .         .         .         .                g.5076
 ggagctggagccggcgcggaggagcgggcggccgcggctgtgccctctcctactcctcac       c.-61

 .         .         .         .         .         .                g.5136
 cgcgcgagcgcggggaaccagtagccgcggctgcttcggttgccgcggtcggtggtcgtt       c.-1

          .         .         .         .         .         .       g.5196
 ATGGATTCTCCATGGGACGAGTTGGCTCTGGCCTTCTCCCGCACGTCCATGTTTCCCTTT       c.60
 M  D  S  P  W  D  E  L  A  L  A  F  S  R  T  S  M  F  P  F         p.20

          .         .         .         .         .   | 02     .    g.16080
 TTTGACATCGCGCACTATCTAGTGTCAGTGATGGCGGTGAAACGTCAGCCGG | GAGCAGCT    c.120
 F  D  I  A  H  Y  L  V  S  V  M  A  V  K  R  Q  P  G |   A  A      p.40

          .         .         .         .         .         .       g.16140
 GCATTGGCATGGAAGAATCCTATTTCAAGCTGGTTTACTGCTATGCTCCACTGTTTTGGT       c.180
 A  L  A  W  K  N  P  I  S  S  W  F  T  A  M  L  H  C  F  G         p.60

          .         .         .         .         .         .       g.16200
 GGAGGAATTTTATCCTGTCTACTGCTTGCAGAGCCTCCATTGAAGTTTCTTGCAAACCAC       c.240
 G  G  I  L  S  C  L  L  L  A  E  P  P  L  K  F  L  A  N  H         p.80

          .         .          | 03        .         .         .    g.32043
 ACTAACATATTACTGGCATCTTCAATCTG | GTATATTACATTTTTTTGCCCGCATGACCTA    c.300
 T  N  I  L  L  A  S  S  I  W  |  Y  I  T  F  F  C  P  H  D  L      p.100

          .         .         .         .         .         .       g.32103
 GTTTCCCAGGGCTATTCATATCTACCTGTTCAACTACTGGCTTCGGGAATGAAGGAAGTG       c.360
 V  S  Q  G  Y  S  Y  L  P  V  Q  L  L  A  S  G  M  K  E  V         p.120

          .         .         .         .         .         .       g.32163
 ACCAGAACTTGGAAAATAGTAGGTGGAGTCACACATGCTAATAGCTATTACAAAAATGGC       c.420
 T  R  T  W  K  I  V  G  G  V  T  H  A  N  S  Y  Y  K  N  G         p.140

          .         .         .     | 04   .         .         .    g.33035
 TGGATAGTCATGATAGCTATTGGATGGGCCCGAG | GTGCAGGTGGTACCATTATAACGAAT    c.480
 W  I  V  M  I  A  I  G  W  A  R  G |   A  G  G  T  I  I  T  N      p.160

          .         .         .         .         .         .       g.33095
 TTTGAGAGGTTGGTAAAAGGAGATTGGAAACCAGAAGGTGATGAATGGCTGAAGATGTCA       c.540
 F  E  R  L  V  K  G  D  W  K  P  E  G  D  E  W  L  K  M  S         p.180

    | 05     .         .         .         .         .         .    g.58606
 TA | CCCTGCCAAGGTAACCCTGCTGGGGTCAGTTATCTTCACATTCCAGCACACCCAGCAT    c.600
 Y  |  P  A  K  V  T  L  L  G  S  V  I  F  T  F  Q  H  T  Q  H      p.200

          .         .         .         .         .         .       g.58666
 CTGGCAATATCAAAGCATAATCTTATGTTCCTTTATACCATCTTTATTGTGGCCACAAAG       c.660
 L  A  I  S  K  H  N  L  M  F  L  Y  T  I  F  I  V  A  T  K         p.220

  | 06       .         .         .         .         .         .    g.84400
  | ATAACCATGATGACTACACAGACTTCTACTATGACATTTGCTCCTTTTGAGGATACATTG    c.720
  | I  T  M  M  T  T  Q  T  S  T  M  T  F  A  P  F  E  D  T  L      p.240

          .         .         .         .         .         .       g.84460
 AGTTGGATGCTATTTGGCTGGCAGCAGCCGTTTTCATCATGTGAGAAGAAAAGTGAAGCA       c.780
 S  W  M  L  F  G  W  Q  Q  P  F  S  S  C  E  K  K  S  E  A         p.260

          .         .         .         .         .         .       g.84520
 AAGTCACCTTCCAATGGCGTTGGGTCATTGGCCTCAAAGCCGGTAGATGTTGCCTCAGAT       c.840
 K  S  P  S  N  G  V  G  S  L  A  S  K  P  V  D  V  A  S  D         p.280

          .         .         .                                     g.84556
 AATGTTAAAAAGAAACATACTAAGAAGAATGAATAA                               c.876
 N  V  K  K  K  H  T  K  K  N  E  X                                 p.291

          .         .         .         .         .         .       g.84616
 atttacgtgatgagctctacaaggccaaaaattttttttcttatctacctgttatattgt       c.*60

          .         .         .         .         .         .       g.84676
 gctaatttttctatgtatgtgatgtgaaatgaagactatatatatggaatggaggtgaca       c.*120

          .         .         .         .         .         .       g.84736
 gaaagaaagaaattctttgtttgagggagacttcccctttctggattgtatttgtagagt       c.*180

          .         .         .         .         .         .       g.84796
 gttacgagtgtatcatgtgattatgctttaccggtataagagattctgttgtgattattt       c.*240

          .         .         .         .         .         .       g.84856
 gaatagttttatattaataaaagaagacaaaattttttaaatgttagaaaaagcagatct       c.*300

          .         .         .         .         .         .       g.84916
 gtcattgcaaagtaacaaaaattttaagcttttaaaaatgtagatttttcatatttttaa       c.*360

          .         .         .         .         .         .       g.84976
 aatttgaatctatttgagctttagttcagcagaattaaatttttacttgacattatcatt       c.*420

          .         .         .         .         .         .       g.85036
 aaaattgctaggtatggagaacaattcctattttattttgaacactgagaagagtaaact       c.*480

          .         .         .         .         .         .       g.85096
 tttcctaaaacactttatattataaatgaaaataaattgctagtttatattttagatata       c.*540

          .         .         .         .         .         .       g.85156
 aacatcatattttttattaatacctacatcaaatggaaaatatctgaaattttttttcca       c.*600

          .         .         .         .         .         .       g.85216
 tagcaggtattttctactagaagtagttttactacttttcatttagaacagagtatgagt       c.*660

          .         .         .         .         .         .       g.85276
 cttaatctgaagtctttttcatgcccttgttttaaaaaaactactttttttggcctcaaa       c.*720

          .         .         .         .         .         .       g.85336
 aaaatcaagggtgtaatttttaataaattgttaatcctatgttttgtaattttcatttta       c.*780

          .         .         .         .         .         .       g.85396
 ggagcttgacttatttttttctctctcataaaaacacatttgttttaattgtaggagaaa       c.*840

          .         .         .         .         .         .       g.85456
 ttttctcagcattttgcatgttctttctaatctttgttggtctgaatatattggtagtaa       c.*900

          .         .         .         .         .         .       g.85516
 ttactgtaattattcaacaaaaagcatatccgttcaaaaatttttccactatgtcttttt       c.*960

          .         .         .         .         .         .       g.85576
 tctagtggctactgttttagttttctagttgaatatctctgacaagctttcgtatggttt       c.*1020

          .         .         .         .         .         .       g.85636
 tgttatattttcatctacatgtaatgtgttattaattttattaaatgaaaactaatcacc       c.*1080

          .         .         .         .         .         .       g.85696
 ttcatgtggaaatgctctgagaattgtccttaggcatttggtagtaaccagctaaccaag       c.*1140

          .         .         .         .         .         .       g.85756
 aagaaacagagaaaccagaacttcatatggcagtccatttagatgaagaatgatgatata       c.*1200

          .         .         .         .         .         .       g.85816
 aaatctggttccttcttagcaaaataaaaaacaaacaagaaaagatactaaatgatgtta       c.*1260

          .         .         .         .         .         .       g.85876
 attttcttactttatgatttagaagtccagttataatattaaaactctgtgacatagttt       c.*1320

          .         .         .         .         .         .       g.85936
 cttttaccaaaaccatgaacctactccccgtatcaggtattttcgatggtttagaagtac       c.*1380

          .         .         .         .         .         .       g.85996
 tcaagtcacatcacattcaagttagaagttttttttttgttgttgttattttaaattttt       c.*1440

          .         .         .         .         .         .       g.86056
 aacaaatataaacaccagcagatactattacttgcttaaaaaattgggagggggcacttt       c.*1500

          .         .         .         .         .         .       g.86116
 tcatagtcttggaatgctaagaagttttatttttaatattgtgacagaaagctttaagta       c.*1560

          .         .         .         .         .         .       g.86176
 tttaagagctctgtattatatttgatactcttacagttaaaaacttttcaaaattaatac       c.*1620

          .         .         .         .         .         .       g.86236
 attgttaattattgaccagttttgaagtttgggtttaactgtagttgaaatggaaggact       c.*1680

          .         .         .         .         .         .       g.86296
 cttgttttacacttgtattaaagataaatttattaaaataagttatttagcaccaatgga       c.*1740

          .         .         .         .         .         .       g.86356
 gtattacattatttttatgttttatatttttcttgaggtagagtttcagaactcatctag       c.*1800

          .         .         .         .         .         .       g.86416
 tattttgactaatatagtatatattcagtgattactgttcaaatgggacattggtagaaa       c.*1860

          .         .         .         .         .         .       g.86476
 ctttattaatctatgcaagtatcctataaccctcaattcaaggctcttttgtaaaaaatg       c.*1920

          .         .         .         .         .         .       g.86536
 tactggagaacatggcttaggcctgaaacccatcctgaatctattcaggtcacctgtaga       c.*1980

          .         .         .         .         .         .       g.86596
 gtcttgacttggatttgcaaagcagattgttagactccttacccaatgtgaagtgtgaat       c.*2040

          .         .         .         .         .         .       g.86656
 aaggcctataggcctgcctcacacagctaatcagaggtggcactgagaaagtcaagtcct       c.*2100

          .         .         .         .         .         .       g.86716
 aataggtctccttaaaaaaaaaaaggagacaaaaagctggcaagaacatgagccagcttc       c.*2160

          .         .         .         .         .         .       g.86776
 cctcagtgctgtcactctcaagtaaaacatggccaaatgaatatcaaactggtttatcag       c.*2220

          .         .         .         .         .         .       g.86836
 attagtcactcttccttactgagggagtatcaagtaagggctggagagagaccagatatg       c.*2280

          .         .         .         .         .         .       g.86896
 tggagttgttggctttcagtggaaatggtagcctccctgtgggtagagaccaaaaggtag       c.*2340

          .         .         .         .         .         .       g.86956
 agagatgacagaagggagactctgattagtgtattttttttttgtctattccttaaagcc       c.*2400

          .         .         .         .         .         .       g.87016
 cagacacctttccattaaaatctacttcaaatcacaagttgattacaattgagtggaaca       c.*2460

          .         .         .         .         .         .       g.87076
 tcccatgttgtaaatggaataatgtgttcagaatgctctttctttcccccaataaagccc       c.*2520

          .                                                         g.87087
 tttatagtgtt                                                        c.*2531

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Transmembrane protein 38B protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center