Sp7 transcription factor (SP7) - coding DNA reference sequence

(used for mutation description)

(last modified August 3, 2010)


This file was created to facilitate the description of sequence variants in the SP7 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_023391.1, covering SP7 transcript NM_001173467.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5002
                                                           ac       c.-121

 .         .         .         .         .         .                g.5062
 ccgttgcctgcactctccctgccagacctccagagaggagagactcgggacagccagccc       c.-61

 .         .   | 02     .         .         .         .             g.5574
 caggttcccccag | ctctctccatctgcctggctccttgggacccgttccccagcctcagg    c.-1

          .         .  | 03      .         .         .         .    g.11839
 ATGGCGTCCTCCCTGCTTGAG | GAGGAAGTTCACTATGGCTCCAGTCCCCTGGCCATGCTG    c.60
 M  A  S  S  L  L  E   | E  E  V  H  Y  G  S  S  P  L  A  M  L      p.20

          .         .         .         .         .         .       g.11899
 ACGGCAGCGTGCAGCAAATTTGGTGGCTCTAGCCCTCTGCGGGACTCAACAACTCTGGGC       c.120
 T  A  A  C  S  K  F  G  G  S  S  P  L  R  D  S  T  T  L  G         p.40

          .         .         .         .         .         .       g.11959
 AAAGCAGGCACAAAGAAGCCGTACTCTGTGGGCAGTGACCTTTCAGCCTCCAAAACCATG       c.180
 K  A  G  T  K  K  P  Y  S  V  G  S  D  L  S  A  S  K  T  M         p.60

          .         .         .         .         .         .       g.12019
 GGGGATGCTTATCCAGCCCCCTTTACAAGCACTAATGGGCTCCTTTCACCTGCAGGCAGT       c.240
 G  D  A  Y  P  A  P  F  T  S  T  N  G  L  L  S  P  A  G  S         p.80

          .         .         .         .         .         .       g.12079
 CCTCCAGCACCCACCTCAGGCTATGCTAATGATTACCCTCCCTTTTCCCACTCATTCCCT       c.300
 P  P  A  P  T  S  G  Y  A  N  D  Y  P  P  F  S  H  S  F  P         p.100

          .         .         .         .         .         .       g.12139
 GGGCCCACAGGCACCCAGGACCCTGGGCTACTAGTGCCCAAGGGGCACAGCTCTTCTGAC       c.360
 G  P  T  G  T  Q  D  P  G  L  L  V  P  K  G  H  S  S  S  D         p.120

          .         .         .         .         .         .       g.12199
 TGTCTGCCCAGTGTCTACACCTCTCTGGACATGACACACCCCTATGGCTCCTGGTACAAG       c.420
 C  L  P  S  V  Y  T  S  L  D  M  T  H  P  Y  G  S  W  Y  K         p.140

          .         .         .         .         .         .       g.12259
 GCAGGCATCCATGCAGGCATTTCACCAGGCCCAGGCAACACTCCTACTCCATGGTGGGAT       c.480
 A  G  I  H  A  G  I  S  P  G  P  G  N  T  P  T  P  W  W  D         p.160

          .         .         .         .         .         .       g.12319
 ATGCACCCTGGAGGCAACTGGCTAGGTGGTGGGCAGGGCCAGGGTGATGGGCTGCAAGGG       c.540
 M  H  P  G  G  N  W  L  G  G  G  Q  G  Q  G  D  G  L  Q  G         p.180

          .         .         .         .         .         .       g.12379
 ACACTGCCCACAGGTCCAGCTCAGCCTCCACTGAACCCCCAGCTGCCCACCTACCCATCT       c.600
 T  L  P  T  G  P  A  Q  P  P  L  N  P  Q  L  P  T  Y  P  S         p.200

          .         .         .         .         .         .       g.12439
 GACTTTGCTCCCCTTAATCCAGCCCCCTACCCAGCTCCCCACCTCTTGCAACCAGGGCCC       c.660
 D  F  A  P  L  N  P  A  P  Y  P  A  P  H  L  L  Q  P  G  P         p.220

          .         .         .         .         .         .       g.12499
 CAGCATGTCTTGCCCCAAGATGTCTATAAACCCAAGGCAGTGGGAAATAGTGGGCAGCTA       c.720
 Q  H  V  L  P  Q  D  V  Y  K  P  K  A  V  G  N  S  G  Q  L         p.240

          .         .         .         .         .         .       g.12559
 GAAGGGAGTGGTGGAGCCAAACCCCCACGGGGTGCAAGCACTGGGGGTAGTGGTGGATAT       c.780
 E  G  S  G  G  A  K  P  P  R  G  A  S  T  G  G  S  G  G  Y         p.260

          .         .         .         .         .         .       g.12619
 GGGGGCAGTGGGGCAGGGCGCTCCTCCTGCGACTGCCCTAATTGCCAGGAGCTAGAGCGG       c.840
 G  G  S  G  A  G  R  S  S  C  D  C  P  N  C  Q  E  L  E  R         p.280

          .         .         .         .         .         .       g.12679
 CTGGGAGCAGCAGCGGCTGGGCTGCGGAAGAAGCCCATCCACAGCTGCCACATCCCTGGC       c.900
 L  G  A  A  A  A  G  L  R  K  K  P  I  H  S  C  H  I  P  G         p.300

          .         .         .         .         .         .       g.12739
 TGCGGCAAGGTGTATGGCAAGGCTTCGCACCTGAAGGCCCACTTGCGCTGGCACACAGGC       c.960
 C  G  K  V  Y  G  K  A  S  H  L  K  A  H  L  R  W  H  T  G         p.320

          .         .         .         .         .         .       g.12799
 GAGAGGCCCTTCGTCTGCAACTGGCTCTTCTGCGGCAAGAGGTTCACTCGTTCGGATGAG       c.1020
 E  R  P  F  V  C  N  W  L  F  C  G  K  R  F  T  R  S  D  E         p.340

          .         .         .         .         .         .       g.12859
 CTGGAGCGTCATGTGCGCACTCACACCCGGGAGAAGAAGTTCACCTGCCTGCTCTGCTCC       c.1080
 L  E  R  H  V  R  T  H  T  R  E  K  K  F  T  C  L  L  C  S         p.360

          .         .         .         .         .         .       g.12919
 AAGCGCTTTACCCGAAGCGACCACCTGAGCAAACACCAGCGCACCCATGGAGAACCAGGC       c.1140
 K  R  F  T  R  S  D  H  L  S  K  H  Q  R  T  H  G  E  P  G         p.380

          .         .         .         .         .         .       g.12979
 CCGGGTCCCCCTCCCAGTGGCCCCAAGGAGCTGGGGGAGGGCCGCAGCACGGGGGAAGAG       c.1200
 P  G  P  P  P  S  G  P  K  E  L  G  E  G  R  S  T  G  E  E         p.400

          .         .         .         .         .         .       g.13039
 GAGGCCAGTCAGACGCCCCGACCTTCTGCCTCGCCAGCAACCCCAGAGAAAGCCCCTGGA       c.1260
 E  A  S  Q  T  P  R  P  S  A  S  P  A  T  P  E  K  A  P  G         p.420

          .         .         .                                     g.13075
 GGCAGCCCTGAGCAGAGCAACTTGCTGGAGATCTGA                               c.1296
 G  S  P  E  Q  S  N  L  L  E  I  X                                 p.431

          .         .         .         .         .         .       g.13135
 gccgggtggaaggtctcccaccccagggctgccctgacagtctctcttggctctctagac       c.*60

          .         .         .         .         .         .       g.13195
 cactgcttgccaatcactctctttaccccatgcatgccatccttcggggctctctccctc       c.*120

          .         .         .         .         .         .       g.13255
 tgtctccctcctggccattctgggcttgggtatctccttgcatgcctcctcagctcacct       c.*180

          .         .         .         .         .         .       g.13315
 tctctcttcaccatgagactggctttccacaaactctcatctcaggccctccccttgtgc       c.*240

          .         .         .         .         .         .       g.13375
 ctgatacctgcactccggcttcctagactctggccctgccacaccaacacactttctatt       c.*300

          .         .         .         .         .         .       g.13435
 tgggctcccaacactatttctccatctcactccttgacatgtacccctttctgcttctca       c.*360

          .         .         .         .         .         .       g.13495
 agcttatttcctgctgtccctcagcctccaggcttcagtcttcccaacttcttacaccat       c.*420

          .         .         .         .         .         .       g.13555
 tgctttccattctccagaactcttttttcctttttacaaacacaatgataatgataattt       c.*480

          .         .         .         .         .         .       g.13615
 attgccccctggtggcctcttcatcaggggtattggggttagtgacctggccagagggtg       c.*540

          .         .         .         .         .         .       g.13675
 ccaagaggggggcagaccagtggggatctgatcccaaagatggggtgaccccagggtcag       c.*600

          .         .         .         .         .         .       g.13735
 ggaggctgcccccaggcctgtatatttaacccctatgtaccaggagtaatgaatagtaat       c.*660

          .         .         .         .         .         .       g.13795
 aattctatttatgtaagttatgatgacgggtcaggtagagtgagctggggagggaagtgg       c.*720

          .         .         .         .         .         .       g.13855
 atccatttctgctaaggaaattctagtcaaatgcatctctgtatagacaaaatgttagtg       c.*780

          .         .         .         .         .         .       g.13915
 gagaagatcttgttaatagaatgtctatcatcagaatctcagttgatagggtttctcttg       c.*840

          .         .         .         .         .         .       g.13975
 taatgaagtctctacaaattgggttagctacatctctgctaaacagttgatggggtatct       c.*900

          .         .         .         .         .         .       g.14035
 cttgattagggggatccctaatatccccagccccagccagaagctgtgaaacctcaagtc       c.*960

          .         .         .         .         .         .       g.14095
 ctatggaggggagaaggactggaatgtaccccatctcccttgactgcagagcaggttcct       c.*1020

          .         .         .         .         .         .       g.14155
 ccactgccccaccccttagacaccatgaccccatcaggttaatcccctgttgccatggtt       c.*1080

          .         .         .         .         .         .       g.14215
 atggagagcttgcagctgccatcttagatgtgctctttggggaagcccatctaacaggag       c.*1140

          .         .         .         .         .         .       g.14275
 gacattggtttgggggtgcacctcctgaagaatgggtggggaaggctttctctaggatca       c.*1200

          .         .         .         .         .         .       g.14335
 gattcaaataagtatgtattgagtgcctactctgtgcaaggcactatgctagatctggtg       c.*1260

          .         .         .         .         .         .       g.14395
 cctagaagccctgagaaagaacttaaagagctaggaggacagaggcccccaagctgatct       c.*1320

          .         .         .         .         .         .       g.14455
 ggtggtgcatccacgcacccccaccctgggactttggatgctcccatctccacctccagt       c.*1380

          .         .         .         .         .         .       g.14515
 gacttttaaagccgcttcgtgcctttcctgtaacgttggatcctccttttctgtcccctg       c.*1440

          .         .         .         .         .         .       g.14575
 ctgtctcaaggccccaagttaaagggttaaagccgctggagcttggggagagaacattgt       c.*1500

          .         .         .         .         .         .       g.14635
 ggaatggaagggatcatgccctttgtggagtcttttttttttaatttaataaataaaagt       c.*1560

          .                                                         g.14646
 tggatttgaaa                                                        c.*1571

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Sp7 transcription factor protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 27
©2004-2010 Leiden University Medical Center