peptidylprolyl isomerase B (cyclophilin B) (PPIB) - coding DNA reference sequence

(used for mutation description)

(last modified November 12, 2009)


This file was created to facilitate the description of sequence variants in the PPIB gene based on a coding DNA reference sequence following the HGVS recommendations.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5049
            actatccggcgccgagccggaggggggaaacggcgcccgccgcccgccc       c.-121

 .         .         .         .         .         .                g.5109
 ggagcccgcgagcaaccccagtcccccccacccgcgcgtggcggcgccggctccctagcc       c.-61

 .         .         .         .         .         .                g.5169
 accgcggccccaccctcttccggcctcagctgtccgggctgctttcgcctccgcctgtgg       c.-1

          .         .         .         .         .         .       g.5229
 ATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCATCGCGGGG       c.60
 M  L  R  L  S  E  R  N  M  K  V  L  L  A  A  A  L  I  A  G         p.20

          .         .         .         .         .         .       g.5289
 TCCGTCTTCTTCCTGCTGCTGCCGGGACCTTCTGCGGCCGATGAGAAGAAGAAGGGGCCC       c.120
 S  V  F  F  L  L  L  P  G  P  S  A  A  D  E  K  K  K  G  P         p.40

          .      | 02  .         .         .         .         .    g.6046
 AAAGTCACCGTCAAG | GTGTATTTTGACCTACGAATTGGAGATGAAGATGTAGGCCGGGTG    c.180
 K  V  T  V  K   | V  Y  F  D  L  R  I  G  D  E  D  V  G  R  V      p.60

          .         .         .         .         .         .       g.6106
 ATCTTTGGTCTCTTCGGAAAGACTGTTCCAAAAACAGTGGATAATTTTGTGGCCTTAGCT       c.240
 I  F  G  L  F  G  K  T  V  P  K  T  V  D  N  F  V  A  L  A         p.80

           | 03        .         .         .         .         .    g.8009
 ACAGGAGAG | AAAGGATTTGGCTACAAAAACAGCAAATTCCATCGTGTAATCAAGGACTTC    c.300
 T  G  E   | K  G  F  G  Y  K  N  S  K  F  H  R  V  I  K  D  F      p.100

          .         .         .         .    | 04    .         .    g.11263
 ATGATCCAGGGCGGAGACTTCACCAGGGGAGATGGCACAGGAG | GAAAGAGCATCTACGGT    c.360
 M  I  Q  G  G  D  F  T  R  G  D  G  T  G  G |   K  S  I  Y  G      p.120

          .         .         .         .         .         .       g.11323
 GAGCGCTTCCCCGATGAGAACTTCAAACTGAAGCACTACGGGCCTGGCTGGGTGAGCATG       c.420
 E  R  F  P  D  E  N  F  K  L  K  H  Y  G  P  G  W  V  S  M         p.140

          .         .         .         .         .         .       g.11383
 GCCAACGCAGGCAAAGACACCAACGGCTCCCAGTTCTTCATCACGACAGTCAAGACAGCC       c.480
 A  N  A  G  K  D  T  N  G  S  Q  F  F  I  T  T  V  K  T  A         p.160

          .         .         .         .         | 05         .    g.12022
 TGGCTAGATGGCAAGCATGTGGTGTTTGGCAAAGTTCTAGAGGGCATG | GAGGTGGTGCGG    c.540
 W  L  D  G  K  H  V  V  F  G  K  V  L  E  G  M   | E  V  V  R      p.180

          .         .         .         .         .         .       g.12082
 AAGGTGGAGAGCACCAAGACAGACAGCCGGGATAAACCCCTGAAGGATGTGATCATCGCA       c.600
 K  V  E  S  T  K  T  D  S  R  D  K  P  L  K  D  V  I  I  A         p.200

          .         .         .         .         .                 g.12133
 GACTGCGGCAAGATCGAGGTGGAGAAGCCCTTTGCCATCGCCAAGGAGTAG                c.651
 D  C  G  K  I  E  V  E  K  P  F  A  I  A  K  E  X                  p.216

          .         .         .         .         .         .       g.12193
 ggcacagggacatctttctttgagtgaccgtctgtgcaggccctgtagtccgccacaggg       c.*60

          .         .         .         .         .         .       g.12253
 ctctgagctgcactggccccggtgctggcatctggtggagcggacccactcccctcacat       c.*120

          .         .         .         .         .         .       g.12313
 tccacaggcccatggactcacttttgtaacaaactcctaccaacactgaccaataaaaaa       c.*180

          .         .                                               g.12341
 aaatgtgggtttttttttttttaatata                                       c.*208

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Peptidylprolyl isomerase B (cyclophilin B) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVDv.2.0-22 Build 22
©2004-2009 Leiden University Medical Center