prolyl 3-hydroxylase 1 (P3H1) - coding DNA reference sequence

(used for mutation description)

(last modified March 26, 2015)


This file was created to facilitate the description of sequence variants in the P3H1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008123.1, covering P3H1 transcript NM_022356.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5053
        atgcgccgcccggcttggaaggtggggcttcgcccgggggcgggccttcgccg       c.-61

 .         .         .         .         .         .                g.5113
 ggggtaggactccggccttggtggcgggtggctggcggttccgttaggtctgagggagcg       c.-1

          .         .         .         .         .         .       g.5173
 ATGGCGGTACGCGCGTTGAAGCTGCTGACCACACTGCTGGCTGTCGTGGCCGCTGCCTCC       c.60
 M  A  V  R  A  L  K  L  L  T  T  L  L  A  V  V  A  A  A  S         p.20

          .         .         .         .         .         .       g.5233
 CAAGCCGAGGTCGAGTCCGAGGCAGGATGGGGCATGGTGACGCCTGATCTGCTCTTCGCC       c.120
 Q  A  E  V  E  S  E  A  G  W  G  M  V  T  P  D  L  L  F  A         p.40

          .         .         .         .         .         .       g.5293
 GAGGGGACCGCAGCCTACGCGCGCGGGGACTGGCCCGGGGTGGTCCTGAGCATGGAACGG       c.180
 E  G  T  A  A  Y  A  R  G  D  W  P  G  V  V  L  S  M  E  R         p.60

          .         .         .         .         .         .       g.5353
 GCGCTGCGCTCCCGGGCAGCCCTCCGCGCCCTTCGCCTGCGCTGCCGCACCCAGTGTGCC       c.240
 A  L  R  S  R  A  A  L  R  A  L  R  L  R  C  R  T  Q  C  A         p.80

          .         .         .         .         .         .       g.5413
 GCCGACTTCCCGTGGGAGCTGGACCCCGACTGGTCCCCCAGCCCGGCCCAGGCCTCGGGC       c.300
 A  D  F  P  W  E  L  D  P  D  W  S  P  S  P  A  Q  A  S  G         p.100

          .         .         .         .         .         .       g.5473
 GCCGCCGCCCTGCGCGACCTGAGCTTCTTCGGGGGCCTTCTGCGTCGCGCTGCCTGCCTG       c.360
 A  A  A  L  R  D  L  S  F  F  G  G  L  L  R  R  A  A  C  L         p.120

          .         .         .         .         .         .       g.5533
 CGCCGCTGCCTCGGGCCGCCGGCCGCCCACTCGCTCAGCGAAGAGATGGAGCTGGAGTTC       c.420
 R  R  C  L  G  P  P  A  A  H  S  L  S  E  E  M  E  L  E  F         p.140

          .         .         .         .      | 02  .         .    g.9624
 CGCAAGCGGAGCCCCTACAACTACCTGCAGGTCGCCTACTTCAAG | ATCAACAAGTTGGAG    c.480
 R  K  R  S  P  Y  N  Y  L  Q  V  A  Y  F  K   | I  N  K  L  E      p.160

          .         .         .         .         .         .       g.9684
 AAAGCTGTTGCTGCAGCACACACCTTCTTCGTGGGCAATCCTGAGCACATGGAAATGCAG       c.540
 K  A  V  A  A  A  H  T  F  F  V  G  N  P  E  H  M  E  M  Q         p.180

          .         .         .         .         .         .       g.9744
 CAGAACCTAGACTATTACCAAACCATGTCTGGAGTGAAGGAGGCCGACTTCAAGGATCTT       c.600
 Q  N  L  D  Y  Y  Q  T  M  S  G  V  K  E  A  D  F  K  D  L         p.200

          .         | 03         .         .         .         .    g.12736
 GAGACTCAACCCCATATG | CAAGAATTTCGACTGGGAGTGCGACTCTACTCAGAGGAACAG    c.660
 E  T  Q  P  H  M   | Q  E  F  R  L  G  V  R  L  Y  S  E  E  Q      p.220

          .         .         .         .         .         .       g.12796
 CCACAGGAAGCTGTGCCCCACCTAGAGGCGGCGCTGCAAGAATACTTTGTGGCCTATGAG       c.720
 P  Q  E  A  V  P  H  L  E  A  A  L  Q  E  Y  F  V  A  Y  E         p.240

          .         .         .         .         .         .       g.12856
 GAGTGCCGTGCCCTCTGCGAAGGGCCCTATGACTACGATGGCTACAACTACCTTGAGTAC       c.780
 E  C  R  A  L  C  E  G  P  Y  D  Y  D  G  Y  N  Y  L  E  Y         p.260

          .         .         | 04         .         .         .    g.13133
 AACGCTGACCTCTTCCAGGCCATCACAG | ATCATTACATCCAGGTCCTCAACTGTAAGCAG    c.840
 N  A  D  L  F  Q  A  I  T  D |   H  Y  I  Q  V  L  N  C  K  Q      p.280

          .         .         .         .         .         .       g.13193
 AACTGTGTCACGGAGCTTGCTTCCCACCCAAGTCGAGAGAAGCCCTTTGAAGACTTCCTC       c.900
 N  C  V  T  E  L  A  S  H  P  S  R  E  K  P  F  E  D  F  L         p.300

          .         .         .         . | 05       .         .    g.14182
 CCATCGCATTATAATTATCTGCAGTTTGCCTACTATAACA | TTGGGAATTATACACAGGCT    c.960
 P  S  H  Y  N  Y  L  Q  F  A  Y  Y  N  I |   G  N  Y  T  Q  A      p.320

          .         .         .         .         .         .       g.14242
 GTTGAATGTGCCAAGACCTATCTTCTCTTCTTCCCCAATGACGAGGTGATGAACCAAAAT       c.1020
 V  E  C  A  K  T  Y  L  L  F  F  P  N  D  E  V  M  N  Q  N         p.340

          .         .         .         .         .         .       g.14302
 TTGGCCTATTATGCAGCTATGCTTGGAGAAGAACACACCAGATCCATCGGCCCCCGTGAG       c.1080
 L  A  Y  Y  A  A  M  L  G  E  E  H  T  R  S  I  G  P  R  E         p.360

  | 06       .         .         .         .         .         .    g.16507
  | AGTGCCAAGGAGTACCGACAGCGAAGCCTACTGGAAAAAGAACTGCTTTTCTTCGCTTAT    c.1140
  | S  A  K  E  Y  R  Q  R  S  L  L  E  K  E  L  L  F  F  A  Y      p.380

          .         .         . | 07       .         .         .    g.16897
 GATGTTTTTGGAATTCCCTTTGTGGATCCG | GATTCATGGACTCCAGAAGAAGTGATTCCC    c.1200
 D  V  F  G  I  P  F  V  D  P   | D  S  W  T  P  E  E  V  I  P      p.400

          .         .    | 08    .         .         .         .    g.17131
 AAGAGATTGCAAGAGAAACAGAA | GTCAGAACGGGAAACAGCCGTACGCATCTCCCAGGAG    c.1260
 K  R  L  Q  E  K  Q  K  |  S  E  R  E  T  A  V  R  I  S  Q  E      p.420

          .         .         .         .         .         .       g.17191
 ATTGGGAACCTTATGAAGGAAATCGAGACCCTTGTGGAAGAGAAGACCAAGGAGTCACTG       c.1320
 I  G  N  L  M  K  E  I  E  T  L  V  E  E  K  T  K  E  S  L         p.440

          .         .      | 09  .         .         .         .    g.19455
 GATGTGAGCAGACTGACCCGGGAAG | GTGGCCCCCTGCTGTATGAAGGCATCAGTCTCACC    c.1380
 D  V  S  R  L  T  R  E  G |   G  P  L  L  Y  E  G  I  S  L  T      p.460

          .         .         .         .         .         .       g.19515
 ATGAACTCCAAACTCCTGAATGGTTCCCAGCGGGTGGTGATGGACGGCGTAATCTCTGAC       c.1440
 M  N  S  K  L  L  N  G  S  Q  R  V  V  M  D  G  V  I  S  D         p.480

          .         .         .    | 10    .         .         .    g.19742
 CACGAGTGTCAGGAGCTGCAGAGACTGACCAAT | GTGGCAGCAACCTCAGGAGATGGCTAC    c.1500
 H  E  C  Q  E  L  Q  R  L  T  N   | V  A  A  T  S  G  D  G  Y      p.500

          .         .         .         .         .         .       g.19802
 CGGGGTCAGACCTCCCCACATACTCCCAATGAAAAGTTCTATGGTGTCACTGTCTTCAAA       c.1560
 R  G  Q  T  S  P  H  T  P  N  E  K  F  Y  G  V  T  V  F  K         p.520

           | 11        .         .         .         .         .    g.21799
 GCCCTCAAG | CTGGGGCAAGAAGGCAAAGTTCCTCTGCAGAGTGCCCACCTGTACTACAAC    c.1620
 A  L  K   | L  G  Q  E  G  K  V  P  L  Q  S  A  H  L  Y  Y  N      p.540

          .         .         .         .         .         .       g.21859
 GTGACGGAGAAGGTGCGGCGCATCATGGAGTCCTACTTCCGCCTGGATACGCCCCTCTAC       c.1680
 V  T  E  K  V  R  R  I  M  E  S  Y  F  R  L  D  T  P  L  Y         p.560

          .         .         .         . | 12       .         .    g.23787
 TTTTCCTACTCTCATCTGGTGTGCCGCACTGCCATCGAAG | AGGTCCAGGCAGAGAGGAAG    c.1740
 F  S  Y  S  H  L  V  C  R  T  A  I  E  E |   V  Q  A  E  R  K      p.580

          .         .         .         .         .         .       g.23847
 GATGATAGTCATCCAGTCCACGTGGACAACTGCATCCTGAATGCCGAGACCCTCGTGTGT       c.1800
 D  D  S  H  P  V  H  V  D  N  C  I  L  N  A  E  T  L  V  C         p.600

          .         .         .         | 13         .         .    g.24308
 GTCAAAGAGCCCCCAGCCTACACCTTCCGCGACTACAG | CGCCATCCTTTACCTAAATGGG    c.1860
 V  K  E  P  P  A  Y  T  F  R  D  Y  S  |  A  I  L  Y  L  N  G      p.620

          .         .         .         .         .     | 14   .    g.24678
 GACTTCGATGGCGGAAACTTTTATTTCACTGAACTGGATGCCAAGACCGTGACG | GCAGAG    c.1920
 D  F  D  G  G  N  F  Y  F  T  E  L  D  A  K  T  V  T   | A  E      p.640

          .         .         .         .         .         .       g.24738
 GTGCAGCCTCAGTGTGGAAGAGCCGTGGGATTCTCTTCAGGCACTGAAAACCCACATGGA       c.1980
 V  Q  P  Q  C  G  R  A  V  G  F  S  S  G  T  E  N  P  H  G         p.660

          .         .         .         .         .         .       g.24798
 GTGAAGGCTGTCACCAGGGGGCAGCGCTGTGCCATCGCCCTGTGGTTCACCCTGGACCCT       c.2040
 V  K  A  V  T  R  G  Q  R  C  A  I  A  L  W  F  T  L  D  P         p.680

          .      | 15  .         .         .         .         .    g.25277
 CGACACAGCGAGCGG | GACAGGGTGCAGGCAGATGACCTGGTGAAGATGCTCTTCAGCCCA    c.2100
 R  H  S  E  R   | D  R  V  Q  A  D  D  L  V  K  M  L  F  S  P      p.700

          .         .         .         .         .         .       g.25337
 GAAGAGATGGACCTCTCCCAGGAGCAGCCCCTGGATGCCCAGCAGGGCCCCCCCGAACCT       c.2160
 E  E  M  D  L  S  Q  E  Q  P  L  D  A  Q  Q  G  P  P  E  P         p.720

          .         .         .         .         .                 g.25388
 GCACAAGAGTCTCTCTCAGGCAGTGAATCGAAGCCCAAGGATGAGCTATGA                c.2211
 A  Q  E  S  L  S  G  S  E  S  K  P  K  D  E  L  X                  p.736

          .         .         .         .         .         .       g.25448
 cagcgtccaggtcagacggatgggtgactagacccatggagaggaactcttctgcactct       c.*60

          .         .         .         .         .         .       g.25508
 gagctggccagcccctcggggctgcagagcagtgagcctacatctgccactcagccgagg       c.*120

          .         .         .         .         .         .       g.25568
 ggaccctgctcacagccttctacatggtgctactgctcttggagtggacatgaccagaca       c.*180

          .         .         .         .         .         .       g.25628
 ccgcaccccctggatctggctgagggctcaggacacaggcccagccacccccaggggcct       c.*240

          .         .         .         .         .         .       g.25688
 ccacaggccgctgcatgacagcgatacagtacttaagtgtctgtgtagacaaccaaagaa       c.*300

          .         .         .         .         .         .       g.25748
 taaatgattcatggttttttttacttggtttgttcagacaatggaaatttgcccattctg       c.*360

                                                                    g.25750
 tc                                                                 c.*362

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Prolyl 3-hydroxylase 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 36
©2004-2015 Leiden University Medical Center