FK506 binding protein 10, 65 kDa (FKBP10) - coding DNA reference sequence

(used for mutation description)

(last modified November 12, 2009)


This file was created to facilitate the description of sequence variants in the FKBP10 gene based on a coding DNA reference sequence following the HGVS recommendations.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5025
                                    cccgagcctctctccctggccaggc       c.-301

 .         .         .         .         .         .                g.5085
 cccaggtctcgcagccagggatggagatggggggagggggaacctagagttctttgtagt       c.-241

 .         .         .         .         .         .                g.5145
 gcctccctcagactctaacacactcagcctggccccctcctcctattgcaaccccctccc       c.-181

 .         .         .         .         .         .                g.5205
 ccgctcctcccggccaggccagctcagtcttcccagcccccattccacgtggaccagcca       c.-121

 .         .         .         .         .         .                g.5265
 gggcgggggtagggaaagaggacaggaagagggggagccagttctgggaggcggggggaa       c.-61

 .         .         .         .         .         .                g.5325
 ggaggttggtggcgactccctcgctcgccctcactgccggcggtcccaactccaggcacc       c.-1

          .         .         .         .         .         .       g.5385
 ATGTTCCCCGCGGGCCCCCCCAGCCACAGCCTCCTCCGGCTCCCCCTGCTGCAGTTGCTG       c.60
 M  F  P  A  G  P  P  S  H  S  L  L  R  L  P  L  L  Q  L  L         p.20

          .         .         .         .         .         .       g.5445
 CTACTGGTGGTGCAGGCCGTGGGGAGGGGGCTGGGCCGCGCCAGCCCGGCCGGGGGCCCC       c.120
 L  L  V  V  Q  A  V  G  R  G  L  G  R  A  S  P  A  G  G  P         p.40

          .         .         .         .         .         .       g.5505
 CTGGAAGATGTGGTCATCGAGAGGTACCACATCCCCAGGGCCTGTCCCCGGGAAGTGCAG       c.180
 L  E  D  V  V  I  E  R  Y  H  I  P  R  A  C  P  R  E  V  Q         p.60

          .         .         .         .         .         .       g.5565
 ATGGGGGATTTTGTGCGCTACCACTACAACGGCACTTTTGAAGATGGCAAGAAGTTTGAT       c.240
 M  G  D  F  V  R  Y  H  Y  N  G  T  F  E  D  G  K  K  F  D         p.80

       | 02  .         .         .         .         .         .    g.9403
 TCAAG | CTATGATCGCAACACCTTGGTGGCCATCGTGGTGGGTGTGGGGCGCCTCATCACT    c.300
 S  S  |  Y  D  R  N  T  L  V  A  I  V  V  G  V  G  R  L  I  T      p.100

          .         .         .         .         .         .       g.9463
 GGCATGGACCGAGGCCTCATGGGCATGTGTGTCAACGAGCGGCGACGCCTCATTGTGCCT       c.360
 G  M  D  R  G  L  M  G  M  C  V  N  E  R  R  R  L  I  V  P         p.120

          .         .         .  | 03      .         .         .    g.10408
 CCCCACCTGGGCTATGGGAGCATCGGCCTGG | CGGGGCTCATTCCACCGGATGCCACCCTC    c.420
 P  H  L  G  Y  G  S  I  G  L  A |   G  L  I  P  P  D  A  T  L      p.140

          .         .         .         .         .         .       g.10468
 TACTTCGATGTGGTTCTGCTGGATGTGTGGAACAAGGAAGACACCGTGCAGGTGAGCACA       c.480
 Y  F  D  V  V  L  L  D  V  W  N  K  E  D  T  V  Q  V  S  T         p.160

          .         .         .         .         .         .       g.10528
 TTGCTGCGCCCGCCCCACTGCCCCCGCATGGTCCAGGACGGCGACTTTGTCCGCTACCAC       c.540
 L  L  R  P  P  H  C  P  R  M  V  Q  D  G  D  F  V  R  Y  H         p.180

          .         .         .         .  | 04      .         .    g.10691
 TACAATGGCACCCTGCTGGACGGCACCTCCTTCGACACCAG | CTACAGTAAGGGCGGCACT    c.600
 Y  N  G  T  L  L  D  G  T  S  F  D  T  S  |  Y  S  K  G  G  T      p.200

          .         .         .         .         .         .       g.10751
 TATGACACCTACGTCGGCTCTGGTTGGCTGATCAAGGGCATGGACCAGGGGCTGCTGGGC       c.660
 Y  D  T  Y  V  G  S  G  W  L  I  K  G  M  D  Q  G  L  L  G         p.220

          .         .         .         .         .         .       g.10811
 ATGTGTCCTGGAGAGAGAAGGAAGATTATCATCCCTCCATTCCTGGCCTATGGCGAGAAA       c.720
 M  C  P  G  E  R  R  K  I  I  I  P  P  F  L  A  Y  G  E  K         p.240

         | 05.         .         .         .         .         .    g.11553
 GGCTATG | GGACAGTGATCCCCCCACAGGCCTCGCTGGTCTTTCACGTCCTCCTGATTGAC    c.780
 G  Y  G |   T  V  I  P  P  Q  A  S  L  V  F  H  V  L  L  I  D      p.260

          .         .         .         .         .         .       g.11613
 GTGCACAACCCGAAGGACGCTGTCCAGCTAGAGACGCTGGAGCTCCCCCCCGGCTGTGTC       c.840
 V  H  N  P  K  D  A  V  Q  L  E  T  L  E  L  P  P  G  C  V         p.280

          .         .         .         .         .         .       g.11673
 CGCAGAGCCGGGGCCGGGGACTTCATGCGCTACCACTACAATGGCTCCTTGATGGACGGC       c.900
 R  R  A  G  A  G  D  F  M  R  Y  H  Y  N  G  S  L  M  D  G         p.300

          .        | 06.         .         .         .         .    g.11863
 ACCCTCTTCGATTCCAG | CTACTCCCGCAACCACACCTACAATACCTATATCGGGCAGGGT    c.960
 T  L  F  D  S  S  |  Y  S  R  N  H  T  Y  N  T  Y  I  G  Q  G      p.320

          .         .         .         .         .         .       g.11923
 TACATCATCCCCGGGATGGACCAGGGGCTGCAGGGTGCCTGCATGGGGGAACGCCGGAGA       c.1020
 Y  I  I  P  G  M  D  Q  G  L  Q  G  A  C  M  G  E  R  R  R         p.340

          .         .         .         .    | 07    .         .    g.12576
 ATTACCATCCCCCCGCACCTCGCCTATGGGGAGAATGGAACTG | GAGACAAGATCCCTGGC    c.1080
 I  T  I  P  P  H  L  A  Y  G  E  N  G  T  G |   D  K  I  P  G      p.360

          .         .         .         .         .         .       g.12636
 TCTGCCGTGCTAATCTTCAACGTCCATGTCATTGACTTCCACAACCCTGCGGATGTGGTG       c.1140
 S  A  V  L  I  F  N  V  H  V  I  D  F  H  N  P  A  D  V  V         p.380

          .         .         .         .         .         .       g.12696
 GAAATCAGGACACTGTCCCGGCCATCTGAGACCTGCAATGAGACCACCAAGCTTGGGGAC       c.1200
 E  I  R  T  L  S  R  P  S  E  T  C  N  E  T  T  K  L  G  D         p.400

          .         .         .         .         .       | 08 .    g.13241
 TTTGTTCGATACCATTACAACTGTTCTTTGCTGGACGGCACCCAGCTGTTCACCTC | GCAT    c.1260
 F  V  R  Y  H  Y  N  C  S  L  L  D  G  T  Q  L  F  T  S  |  H      p.420

          .         .         .         .         .         .       g.13301
 GACTACGGGGCCCCCCAGGAGGCGACTCTCGGGGCCAACAAGGTGATCGAAGGCCTGGAC       c.1320
 D  Y  G  A  P  Q  E  A  T  L  G  A  N  K  V  I  E  G  L  D         p.440

          .         .         .         .         .         .       g.13361
 ACGGGCCTGCAGGGCATGTGTGTGGGAGAGAGGCGGCAGCTCATCGTGCCCCCGCACCTG       c.1380
 T  G  L  Q  G  M  C  V  G  E  R  R  Q  L  I  V  P  P  H  L         p.460

          .          | 09        .         .         .         .    g.13985
 GCCCACGGGGAGAGTGGAG | CCCGGGGAGTCCCAGGCAGTGCTGTGCTGCTGTTTGAGGTG    c.1440
 A  H  G  E  S  G  A |   R  G  V  P  G  S  A  V  L  L  F  E  V      p.480

          .         .         .         .         .         .       g.14045
 GAGCTGGTGTCCCGGGAGGATGGGCTGCCCACAGGCTACCTGTTTGTGTGGCACAAGGAC       c.1500
 E  L  V  S  R  E  D  G  L  P  T  G  Y  L  F  V  W  H  K  D         p.500

          .         .         .         .         .         .       g.14105
 CCTCCTGCCAACCTGTTTGAAGACATGGACCTCAACAAGGATGGCGAGGTCCCTCCGGAG       c.1560
 P  P  A  N  L  F  E  D  M  D  L  N  K  D  G  E  V  P  P  E         p.520

     | 10    .         .         .         .         .         .    g.14570
 GAG | TTCTCCACCTTCATCAAGGCTCAAGTGAGTGAGGGCAAAGGACGCCTCATGCCTGGG    c.1620
 E   | F  S  T  F  I  K  A  Q  V  S  E  G  K  G  R  L  M  P  G      p.540

          .         .         .         .         .         .       g.14630
 CAGGACCCTGAGAAAACCATAGGAGACATGTTCCAGAACCAGGACCGCAACCAGGACGGC       c.1680
 Q  D  P  E  K  T  I  G  D  M  F  Q  N  Q  D  R  N  Q  D  G         p.560

          .         .         .         .         .         .       g.14690
 AAGATCACAGTCGACGAGCTCAAGCTGAAGTCAGATGAGGACGAGGAGCGGGTCCACGAG       c.1740
 K  I  T  V  D  E  L  K  L  K  S  D  E  D  E  E  R  V  H  E         p.580

                                                                    g.14699
 GAGCTCTGA                                                          c.1749
 E  L  X                                                            p.582

          .         .         .         .         .         .       g.14759
 ggggcagggagcctggccaggcctgagacacagaggcccactgcgagggggacagtggcg       c.*60

          .         .         .         .         .         .       g.14819
 gtgggactgacctgctgacagtcaccctccctctgctgggatgaggtccaggagccaact       c.*120

          .         .         .         .         .         .       g.14879
 aaaacaatggcagaggagacatctctggtgttcccaccaccctagatgaaaatccacagc       c.*180

          .         .         .         .         .         .       g.14939
 acagacctctaccgtgtttctcttccatccctaaaccacttccttaaaatgtttggattt       c.*240

          .         .         .         .         .         .       g.14999
 gcaaagccaatttggggcctgtggagcctggggttggatagggccatggctggtccccca       c.*300

          .         .         .         .         .         .       g.15059
 ccatacctcccctccacatcactgacacagctgagcttgttatccatctccccaaacttt       c.*360

          .         .         .         .         .         .       g.15119
 ctctttctttgtacttcttgtcatccccactcccagccccttttcctctatgtgacagct       c.*420

          .         .         .         .         .         .       g.15179
 ccctaggacccctctgccttcctccccaatcctgactggctcctagggaaggggaaggct       c.*480

          .         .         .         .         .         .       g.15239
 cctggagggcagccctacctctcccatgccctttgccctcctccctcgcctccagtggag       c.*540

          .         .         .         .         .         .       g.15299
 gctgagctgaccctgggctgctggaggccagactgggctgtagttagcttttcatcccta       c.*600

          .         .         .         .         .         .       g.15359
 aagaaggctcctttccctaaggaaccatagaagagaggaagaaaacaaagggcatgtgtg       c.*660

          .         .         .         .         .         .       g.15419
 agggaagctgcttgggtgggtgttagggctatgaaatcttggatttggggctgaggggtg       c.*720

          .         .         .         .         .         .       g.15479
 ggagggagggcagagctctgcacactcaaaggctaaactggtgtcagtccttttttcctt       c.*780

          .         .                                               g.15508
 tgttccaaataaaagattaaaccaatggc                                      c.*809

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The FK506 binding protein 10, 65 kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVDv.2.0-22 Build 22
©2004-2009 Leiden University Medical Center