family with sequence similarity 46 member A (FAM46A) - upstream reference sequence


              g.1             .         .         .             g.38
              c.-5318 tgttgccgatcttccacaggccctgaataatgaataaa    c.-5281

.         .         .         .         .         .             g.98
cattttttattttctgaagaaacataggaaacgtcatttcacaagcaccatttccctgtg    c.-5221

.         .         .         .         .         .             g.158
aaaacaggtaatttattttcccaagtgagttttaatttttacatgaagcactttgatcag    c.-5161

.         .         .         .         .         .             g.218
ttgcttttctacaaacactaactggacagcagagagatgttcagtttactctgcaaagaa    c.-5101

.         .         .         .         .         .             g.278
ggcatatgtgtgtgcatgcttggaaaagcatgcaataccccagtggtctctggaattact    c.-5041

.         .         .         .         .         .             g.338
aggatttgcaccacaaaggcagcaaataggtgggggacagacaagggtgggggagtactc    c.-4981

.         .         .         .         .         .             g.398
aaattcttcacactaccactgctctgcctgcattgcagggtgcttctagaagtacatgcc    c.-4921

.         .         .         .         .         .             g.458
actttttgtagaaaggttccaagagcagaagtggtagaaggtggaaaatcaagagagaca    c.-4861

.         .         .         .         .         .             g.518
gtggagagggctggtgtggaaagaccaaaagcaggacaggaatgttgggggagactggct    c.-4801

.         .         .         .         .         .             g.578
agaatgctatgagagagggaagtagcaggcttaatggcaggttttgtgtgtggcggcggg    c.-4741

.         .         .         .         .         .             g.638
gtgggggctggtgggtgcttttttcttctatctctccttctgggtatgaacttgaatgaa    c.-4681

.         .         .         .         .         .             g.698
taatttcatatttggtggcttcccatcttctgaaaccatttttgagaaggtaggaagcag    c.-4621

.         .         .         .         .         .             g.758
ggcaagaaggggaaagtaccactaattgaacatggggcagtcttcaaacaccccattgtg    c.-4561

.         .         .         .         .         .             g.818
tttcagtgtgtctggtgtttgttgcaaattctccataaggtgctggcttgctagctctct    c.-4501

.         .         .         .         .         .             g.878
gctgccacagaggtcattcgtggctgctggggaagaagtggccatctgctttgtcaggtc    c.-4441

.         .         .         .         .         .             g.938
attgtgcattctggccctcagcagttgtttcaggataaaatcacttggtctccaaagtta    c.-4381

.         .         .         .         .         .             g.998
tgcccaacctgaatgtccagaacttggaaagaaagaagaatcagagtgcagttccagctc    c.-4321

.         .         .         .         .         .             g.1058
aagtttaagtctaggaggaatatgacaagactggggacaagccaagtcacagaatgtaag    c.-4261

.         .         .         .         .         .             g.1118
gaactgacgtgcatgggtctgaaccaaggctctgtgatttctctaagttacttaaccttc    c.-4201

.         .         .         .         .         .             g.1178
ttatgccctatctttcctatggagatataatgtgtacagctctggtttttagagaaagtt    c.-4141

.         .         .         .         .         .             g.1238
tagaaaaaataatgtatataaaatatttagcagagtttctgggatataataacaaactca    c.-4081

.         .         .         .         .         .             g.1298
ataataataactatcattaaggccgaagctgaacatcttattttgctaagtccagattga    c.-4021

.         .         .         .         .         .             g.1358
ttgttactgtaactttaaaaataagatgaactaattataagtgtttctttctcaaaattc    c.-3961

.         .         .         .         .         .             g.1418
tatgcaaagctttcctttaaaactttcaggataaggactttttttctgctcgcttagaaa    c.-3901

.         .         .         .         .         .             g.1478
gcagtttaaatttaggctgtccgtatttcagttttgtggtggtcttaactttatcaacta    c.-3841

.         .         .         .         .         .             g.1538
agagcttcatattgccacaggtgtttttttttttccttttaagtgggagaaagtaaataa    c.-3781

.         .         .         .         .         .             g.1598
tttatcaaataggttcagaagctaaagcctgggggaaaaatttagcaactttgcatctaa    c.-3721

.         .         .         .         .         .             g.1658
atttaatctaagagtaactgtgttgagaaatatcttagttgtgaatgtatttggaaagta    c.-3661

.         .         .         .         .         .             g.1718
taggcgttctcatttcataattattttggttatctagaaaaaaattatggtttcaatagc    c.-3601

.         .         .         .         .         .             g.1778
agaatatgcaattttatttaaggatggatattttttcctagaatgtaaatattatttcag    c.-3541

.         .         .         .         .         .             g.1838
tttgaagacaggaaaaagtgggacagtgaacaacatatgctttcattcaacagtatgtaa    c.-3481

.         .         .         .         .         .             g.1898
tgattggtcactatgtatcaggcacatattaatccagtcaaagattaaattgcccacaaa    c.-3421

.         .         .         .         .         .             g.1958
ggcattgccaaaagtaagatatcccagatgtcccaatgcaggaggcagtagggtctggat    c.-3361

.         .         .         .         .         .             g.2018
tatggttgggaaagggggaatgttttgttaaaggtttaaggaagtgtcagccacaaagca    c.-3301

.         .         .         .         .         .             g.2078
ttggatgcttgggggagaggcggtcttggcacactgctgctgggattatcttcttctccc    c.-3241

.         .         .         .         .         .             g.2138
cagcacagcatatagcacgtaagcgggccctgcaagtccagcttcatgctgtgcttccac    c.-3181

.         .         .         .         .         .             g.2198
ctctcagttgtgccctccatttctgggaatggccatgggatcagcctttgcttgggggag    c.-3121

.         .         .         .         .         .             g.2258
ggtccccacttagagaactggactatggtggctgttctcagtgcagcgcaaagtgtggct    c.-3061

.         .         .         .         .         .             g.2318
gggcccttgtgtcaggatcaccatgacagcttgccaaaatgcagattcctttggtgctac    c.-3001

.         .         .         .         .         .             g.2378
agaacgaaatcctgggtatgcataggcaggtgtccatcagctctaagagtcttctttatt    c.-2941

.         .         .         .         .         .             g.2438
ttcagtttttggagcaagggtaaaaataaagtacaaaataattgtagtagagctaaacac    c.-2881

.         .         .         .         .         .             g.2498
acacacatgcacacacccttggtttttaaagtacagcgtgtctaatatacgatctattac    c.-2821

.         .         .         .         .         .             g.2558
tttggctttgttttaagaaggggcagaattcataccggtctttgaaagaaacatttttaa    c.-2761

.         .         .         .         .         .             g.2618
caggtcttttttcttttctttttcttttctcttctcttttcttctttactcttctcttcc    c.-2701

.         .         .         .         .         .             g.2678
cccccttttcttttctttttcccttcccttcccctcccttcctccatttccttttcttct    c.-2641

.         .         .         .         .         .             g.2738
tttccccctccccttccctcccctccccatcgttccttcttcctatttgtgcttgtcttg    c.-2581

.         .         .         .         .         .             g.2798
ttttccaataagaaggtactgataagctacagaccactcgttaccccgtaatgaccacta    c.-2521

.         .         .         .         .         .             g.2858
aacagcattcacagccaaatgggttgggttaaaggcctgaccccacaacttattagttgt    c.-2461

.         .         .         .         .         .             g.2918
ggaacttgggaatgtttcttaacttcttggattcctctgtttctagatccctaggagatg    c.-2401

.         .         .         .         .         .             g.2978
gaaataccttcttcttgaagattaaattaggtattatgttaaggagctaaacaggttata    c.-2341

.         .         .         .         .         .             g.3038
gcccagacgtgttcaataagttcctggtactcataaaccttatctcaaggcactaccaat    c.-2281

.         .         .         .         .         .             g.3098
ctcatttattaatcacgggagtgtacatatccttcctcaaacattctccaactccatacg    c.-2221

.         .         .         .         .         .             g.3158
cttccctttgtagataacgctcttctcctctttccccgactactgaaagaacatccattc    c.-2161

.         .         .         .         .         .             g.3218
tttcaagatccagtccaaatgacaccttctcgggtgtctctccgtttcctatgtagttag    c.-2101

.         .         .         .         .         .             g.3278
cccgccacgcgattgcgtcagaatatacttctctcataatacatatgcaactgaaccata    c.-2041

.         .         .         .         .         .             g.3338
attatgcacctaggtgctatgccctctagattacgtgaaatgtcattcttaaatcttcag    c.-1981

.         .         .         .         .         .             g.3398
cacttagcctgttgcctggcacgtaacaggtcactaaatgctctctctatacacatgctc    c.-1921

.         .         .         .         .         .             g.3458
acacaagaatatgcatatgtatatatatgtataaaatgcctggttaagatagattcatgc    c.-1861

.         .         .         .         .         .             g.3518
gccgatggctggtcagaggaacacatgggtgtgctctgaaggaagcgatggccctatgcg    c.-1801

.         .         .         .         .         .             g.3578
gacagggtagttgtcctagagtccccaggcgcacctcagtgcttaggcgcagcgctgagg    c.-1741

.         .         .         .         .         .             g.3638
ggatggcctctgccacagagacagtcggatttctccattttgggacgcagctcggcaggg    c.-1681

.         .         .         .         .         .             g.3698
caccgggagggggcggcgttgtcacgcagctggatgctccacgggtgacacccccgcacc    c.-1621

.         .         .         .         .         .             g.3758
ctacccctcacccccgagccgcgcagcttgagtgactaggccggggctcccccagttagg    c.-1561

.         .         .         .         .         .             g.3818
aggtgcgggctgtttttcctcccagtctgggcgggcagggctgagcagggtttggggagt    c.-1501

.         .         .         .         .         .             g.3878
attctgtgaccctggcattctcccctctgccccacctcagcccccggcagcgtctaggcg    c.-1441

.         .         .         .         .         .             g.3938
ctgggaaagctgctccgggttagttgatggaggcagcgagctgccgaagagacggccaca    c.-1381

.         .         .         .         .         .             g.3998
gctttctagcaaagagtggtggtggcgcgagtgagcgtgcgtagaattagctctgccgaa    c.-1321

.         .         .         .         .         .             g.4058
gtcaccgaagctggaggagagaattcattttattcttgaaactcctacttttacgtctcg    c.-1261

.         .         .         .         .         .             g.4118
tggaaaaccaaatcgtattccactgacactatgatgcacttaaaatggccaaactttagg    c.-1201

.         .         .         .         .         .             g.4178
gggccgcgaggaacgcgcttcgccgcctccaattttgtcagagaactcgcagcaaaggca    c.-1141

.         .         .         .         .         .             g.4238
ccggacacctagcggccctttccctggactccggggcagcacgcactccccgggcgcgct    c.-1081

.         .         .         .         .         .             g.4298
ctctgcgcccactcggcccgcccagtcctcggccattggctgctcgcccgcgtctgctcc    c.-1021

.         .         .         .         .         .             g.4358
gtgacgcgccctgacccccgcgaagtactggccccttggagccactcgtgcgcaggagcc    c.-961

.         .         .         .         .         .             g.4418
gcgcacgcccgaggcccgtggtgccgcccccgcgccttctcgggctcgcccagagctccc    c.-901

.         .         .         .         .         .             g.4478
cggcgcgcttcccgaggtttcgagaatcgaaacccagttatcaacaagcccttcccactc    c.-841

.         .         .         .         .         .             g.4538
acgcgccgtgactgatttgcgtgcaagagtggactcatgagtccacacttggatcgggtt    c.-781

.         .         .         .         .         .             g.4598
tatcaatggagtaaatggtctacctaaaaaccgaggtttaaaagagcggtcgtgaggaac    c.-721

.         .         .         .         .         .             g.4658
ctccggagcccaaccgtgatgatctaaagacgggctgagtccgcgagaattttgggaagt    c.-661

.         .         .         .         .         .             g.4718
ttctgcagttgcaggattttagtcgtgatctggttttgatgaccacttatgattcctggg    c.-601

.         .         .         .         .         .             g.4778
gcatttaaagtgtctcctcctggggaaaatgaaaagagatttgtgggagggggcgtacat    c.-541

.         .         .         .         .         .             g.4838
aaattaaatgtatgtataaatacacgcatctacgggcgcacacagtatccgcacatacag    c.-481

.         .         .         .         .         .             g.4898
cccaggacctcacgctcaccggcagtcgtcccgcactaactgctgggctagtcagctgcg    c.-421

.         .         .         .         .         .             g.4958
tgccctgcgggcgggggagggcagagggggcggcgccctatgcagatgaggagggtgtgg    c.-361

.         .         .         .         .            .          g.5018
cgaacgtgccgctctgggccccggaagcgcagagaagcccgg \ tataaaaaaagtactgaa c.-301


Powered by LOVD v.2.0 Build 36
©2004-2018 Leiden University Medical Center