family with sequence similarity 46 member A (FAM46A) - 1118 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.6182
gtaacaccacccgagatgcacttgggtcctgacccagtctgggccgggtgtgacggggag  c.552+60

         .         .         .         .         .         .  g.6242
cgggcagaggggcatcggttaaatgccatgaatctgtggccatcacgagtttgggcgcgc  c.552+120

         .         .         .         .         .         .  g.6302
gttatttctttgatttttgattttttaaaccagtaaactgacgtgcgtggacggtgttga  c.552+180

         .         .         .         .         .         .  g.6362
gtgtttcagtttacttgatgctttggcgctacaactcttctcccaggtcctcctctgccc  c.552+240

         .         .         .         .         .         .  g.6422
tctcttctcttctttctccttatgttttaactcttggctttccctgttggagtcttgtcc  c.552+300

         .         .         .         .         .         .  g.6482
agagtagattctgatacttggcagaatgaaatgatgtaaataatttttgagtcattatat  c.552+360

         .         .         .         .         .         .  g.6542
ttgagtctagcctttgggaaaataacagcctgaagcagaagtgagtcaatgagtttttta  c.552+420

         .         .         .         .         .         .  g.6602
ttgtactggaaaaggtgaatagatttcacagcggcattcagctgactacgtgttaaaggt  c.552+480

         .         .         .         .         .         .  g.6662
ctatctggtggttcttcgtgctggttcatatgttaagggtatagtggcaccccctcccca  c.552+540

         .           g.6681
ccctccactttagttcaag  c.552+559

--------------------- middle of intron ---------------------
                              g.6682              .           g.6700
                              c.553-559  acgggttttatatgattag  c.553-541

.         .         .         .         .         .           g.6760
ttaaaattgtctgaggaggcaggctcctggaatgtcataatttagtttatatttgattgt  c.553-481

.         .         .         .         .         .           g.6820
aactgcagggtgcccctggagggacacacaagatactgataacattgattgccgcaggcg  c.553-421

.         .         .         .         .         .           g.6880
gagaggaattgggtggcttggaacaagggcgagaggctgactaacctaccgctgaatgcc  c.553-361

.         .         .         .         .         .           g.6940
cttccgagtcttttgaatgttgtttggatactgtgtgaatattgtgcctattagaccgtt  c.553-301

.         .         .         .         .         .           g.7000
ttcaaaaagtaacacttaaaaagtcagacatgacaacaaaacctcttactactgtgctac  c.553-241

.         .         .         .         .         .           g.7060
gtctgccaaaagcctcaaactattacctctagtccctttcccagacagtaaaactactcg  c.553-181

.         .         .         .         .         .           g.7120
ttaaaagtattttttttctattttcagaagaccgtttaagcctgtaggtagtgtttggct  c.553-121

.         .         .         .         .         .           g.7180
gaaacttgacaaaacaaaagggaaagagcaaaataattctcagctgtgaagaggatgtat  c.553-61

.         .         .         .         .         .           g.7240
ttatttattgatttattattttctaggtttgctcattttgttttatcttttaaattgtag  c.553-1


Powered by LOVD v.2.0 Build 36
©2004-2018 Leiden University Medical Center