family with sequence similarity 46 member A (FAM46A) - 252 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5341
gtgacacagacgggactctcgcttgcgctttccagatgcatcagagatacttttggtgcg  c.-38+60

         .         .         .         .         .         .  g.5401
gggctgctctgcggggcgcggtgcgcggctggggactgtaagggccgggggagggagtct  c.-38+120

        g.5407
ccgagg  c.-38+126

--------------------- middle of intron ---------------------
                                           g.5408             g.5413
                                           c.-37-126  aggccc  c.-37-121

.         .         .         .         .         .           g.5473
ggggtcagggaactatcgggggagggggcgctcttttcctggcgggcctctgctctccgc  c.-37-61

.         .         .         .         .         .           g.5533
cgccgcgcgtgctctccgccgccgcgcgtcctcaccgcgctcctttccctttctttttag  c.-37-1


Powered by LOVD v.2.0 Build 36
©2004-2018 Leiden University Medical Center