family with sequence similarity 46 member A (FAM46A) - downstream reference sequence


            .         .         .         .         .         . g.12037
attga / tttgtgtttgctgtctacaatgtctgtattgactaaagaccatgtcctttgaatc c.*4020

         .         .         .         .         .         .    g.12097
ccaacccacgtcctttagaaaaggcagagcggtacatagagaagagtagccttcagccac    c.*4080

         .         .         .         .         .         .    g.12157
tttctgattgaagcacaataaatgaaaacatccagctgtcagtcagcccatctctgactg    c.*4140

         .         .         .         .         .         .    g.12217
gctcagttagctccaaaagcatctagctaatagatgccaacaatttttttgtctgggtat    c.*4200

         .         .         .         .         .         .    g.12277
caatttagcagtgttaagtgaccagaagtcagaactgttttccgatatcagtagagactc    c.*4260

         .         .         .         .         .         .    g.12337
atggctctagtaggctgtagggctctagtagctctgcgtgagccttggtcttcctgagta    c.*4320

         .         .         .         .         .         .    g.12397
gccttagggctgtgatttcatcagtggttatatagattctgttcgaggctctatagtgtt    c.*4380

         .         .         .         .         .         .    g.12457
attcagagtttttacgttggggtgagaggaattggtggccaggaattgaaagaggaagta    c.*4440

         .         .         .         .         .         .    g.12517
tagagaaggaagagcaatcaaaagatctagtatgttctgtgtgtgtgtgtgtgtgtgtgt    c.*4500

         .         .         .         .         .         .    g.12577
gtgtgtgtgtgtgtgttgggtgcaaggaaatcacccttttgtctagcatttaatgtaacc    c.*4560

         .         .         .         .         .         .    g.12637
tcacctattcaaattgctagggggcatacatttatgtattaattaaaatttttcttagtg    c.*4620

         .         .         .         .         .         .    g.12697
taattttggagatggtctcaatgctagtagtatgagaatttggtaagcccaggctactat    c.*4680

         .         .         .         .         .         .    g.12757
aggatatacatgtggttgtaaaaaccacttaaagtcttgatcttgaatagaatgcatgct    c.*4740

         .         .         .         .         .         .    g.12817
tgacaccgagtctgtgaaagagcaactcttggcattgaaaaccagcttccttcccgtata    c.*4800

         .         .         .         .         .         .    g.12877
cagtgcatcataaaaatacaaggtggttatttggtttgataatggtatttgtgtgtcatt    c.*4860

         .         .         .         .         .         .    g.12937
ttcttcttcctttgttgcagcctcttcattctacagccagttcctcatatgtctgtggtc    c.*4920

         .         .         .         .         .         .    g.12997
accacataattatttttaaacaatggttgaataagagcagtatatattaaacttctccta    c.*4980

         .         .         .         .         .         .    g.13057
ggcttagatataccctgccatttctagttgaattactaggctgcccctcctagctgagcc    c.*5040

         .         .         .         .         .         .    g.13117
tggagagaagtaatccacccttcctttccttagtaacctcattccctaaacttctaattc    c.*5100

         .         .         .         .         .         .    g.13177
ctttagtaagaaaaagaaagaacaaaatataccaaaaaagaaaaataaattaatatcata    c.*5160

         .         .         .         .         .         .    g.13237
gtttttaaatataaagtagaataaggtttgttaaaatcaagtaattccaaaattaaactc    c.*5220

         .         .         .         .         .         .    g.13297
taattttctttaaaggaccaagtttgagatcaacaatatgaacacagtatccttcagtct    c.*5280

         .         .         .         .         .         .    g.13357
aatagcaaatacatcacgtaggaccgagggaggagaaatgattttaaaatgacagtggct    c.*5340

         .         .         .         .         .         .    g.13417
tttacctagcatgactcagatcttggtttctaatgccattctccaataaaaggaactaga    c.*5400

         .         .         .         .         .         .    g.13477
agttgaatctatgtctggagcaggaaatatataagagaagcctgaagcatcttgtggtgc    c.*5460

         .         .         .         .         .         .    g.13537
cttgagaaagcataaaaaaaagataaaaatcataatgatgagggtggcaggggtatgtca    c.*5520

         .         .         .         .         .         .    g.13597
aagggacataggagctaactgaaagagctccaatagccaaagctggaacaatttaagcaa    c.*5580

         .         .         .         .         .         .    g.13657
caaaataaatagtaatggattataacacaacgagtaaagtatccatgcattcacactgat    c.*5640

         .         .         .         .         .         .    g.13717
ataaataaatgattgaatgaacaaatggagggaaagaaatttactgtgcaggattccaaa    c.*5700

         .         .         .         .         .         .    g.13777
taatcaatgtagatattggcccttcaaggaggtggaggttaactacccacctcttaagtg    c.*5760

         .         .         .         .         .         .    g.13837
taggctgtgcatagtgacttatgtccaaagattacaatctggaaaagggaaaaagaagag    c.*5820

         .         .         .         .         .         .    g.13897
tactgtaccattgcaaaaaccgaacaaacactacctcagccagctgatcaaggccaacat    c.*5880

         .         .         .         .         .         .    g.13957
aagtagtgacaagtcatgatgatagtatgtgcccttgttgtgatgtgataagaatggcac    c.*5940

         .         .                                            g.13982
ttcacctctgtggttttttcctcaa                                       c.*5965


Powered by LOVD v.2.0 Build 36
©2004-2018 Leiden University Medical Center