family with sequence similarity 46 member A (FAM46A) - coding DNA reference sequence

(used for mutation description)

(last modified January 26, 2018)


This file was created to facilitate the description of sequence variants in the FAM46A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_056210.1, covering FAM46A transcript NM_017633.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5018
                                           tataaaaaaagtactgaa       c.-301

 .         .         .         .         .         .                g.5078
 gacattttccccgcacaactgctaaagctccagagacacgagcgtgtgtggcagcaagag       c.-241

 .         .         .         .         .         .                g.5138
 ccgccagttcgggaccaccgcagctggggtggcagcggcgcaggaggggtcgcggggagg       c.-181

 .         .         .         .         .         .                g.5198
 gagtggtgagcgcaggcggcaggggtctgggaaagacgaagtcgctatttgctgtctgag       c.-121

 .         .         .         .         .         .                g.5258
 cgcgctcgcagctcctggaagtgttgccgcctctcggtttcgctctcgctcgctgcgctc       c.-61

 .         .         .   | 02     .         .         .             g.5570
 ctagaaggggcggccgcctccag | gactgaccagggccaagtggcgctcggcgggcactac    c.-1

          .         .         .         .         .         .       g.5630
 ATGGCGGAGGGTGAAGGGTACTTCGCCATGTCTGAGGACGAGCTGGCCTGCAGCCCCTAC       c.60
 M  A  E  G  E  G  Y  F  A  M  S  E  D  E  L  A  C  S  P  Y         p.20

          .         .         .         .         .         .       g.5690
 ATCCCCCTAGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGC       c.120
 I  P  L  G  G  D  F  G  G  G  D  F  G  G  G  D  F  G  G  G         p.40

          .         .         .         .         .         .       g.5750
 GACTTCGGCGGTGGCGGCAGCTTCGGTGGGCATTGCTTGGACTATTGCGAAAGCCCTACG       c.180
 D  F  G  G  G  G  S  F  G  G  H  C  L  D  Y  C  E  S  P  T         p.60

          .         .         .         .         .         .       g.5810
 GCGCACTGCAATGTGCTGAACTGGGAGCAAGTGCAGCGGCTGGACGGCATCCTGAGCGAG       c.240
 A  H  C  N  V  L  N  W  E  Q  V  Q  R  L  D  G  I  L  S  E         p.80

          .         .         .         .         .         .       g.5870
 ACCATTCCGATTCACGGGCGCGGCAACTTCCCCACGCTCGAGCTGCAGCCGAGCCTGATC       c.300
 T  I  P  I  H  G  R  G  N  F  P  T  L  E  L  Q  P  S  L  I         p.100

          .         .         .         .         .         .       g.5930
 GTGAAGGTGGTGCGGCGGCGCCTGGCCGAGAAGCGCATTGGCGTCCGCGACGTGCGCCTC       c.360
 V  K  V  V  R  R  R  L  A  E  K  R  I  G  V  R  D  V  R  L         p.120

          .         .         .         .         .         .       g.5990
 AACGGCTCGGCAGCCAGCCATGTCCTGCACCAGGACAGCGGCCTGGGCTACAAGGACCTG       c.420
 N  G  S  A  A  S  H  V  L  H  Q  D  S  G  L  G  Y  K  D  L         p.140

          .         .         .         .         .         .       g.6050
 GACCTCATCTTCTGCGCCGACCTGCGCGGGGAAGGGGAGTTTCAGACTGTGAAGGACGTC       c.480
 D  L  I  F  C  A  D  L  R  G  E  G  E  F  Q  T  V  K  D  V         p.160

          .         .         .         .         .         .       g.6110
 GTGCTGGACTGCCTGTTGGACTTCTTACCCGAGGGGGTGAACAAAGAGAAGATCACACCA       c.540
 V  L  D  C  L  L  D  F  L  P  E  G  V  N  K  E  K  I  T  P         p.180

          .   | 03     .         .         .         .         .    g.7288
 CTCACGCTCAAG | GAAGCTTATGTGCAGAAAATGGTTAAAGTGTGCAATGACTCTGACCGA    c.600
 L  T  L  K   | E  A  Y  V  Q  K  M  V  K  V  C  N  D  S  D  R      p.200

          .         .         .         .         .         .       g.7348
 TGGAGTCTTATATCCCTGTCAAACAACAGTGGCAAAAATGTGGAACTGAAATTTGTGGAT       c.660
 W  S  L  I  S  L  S  N  N  S  G  K  N  V  E  L  K  F  V  D         p.220

          .         .         .         .         .         .       g.7408
 TCCCTCCGGAGGCAGTTTGAATTCAGTGTAGATTCTTTTCAAATCAAATTAGACTCTCTT       c.720
 S  L  R  R  Q  F  E  F  S  V  D  S  F  Q  I  K  L  D  S  L         p.240

          .         .         .         .         .         .       g.7468
 CTGCTCTTTTATGAATGTTCAGAGAACCCAATGACTGAGACATTTCACCCCACAATAATC       c.780
 L  L  F  Y  E  C  S  E  N  P  M  T  E  T  F  H  P  T  I  I         p.260

          .         .         .         .         .         .       g.7528
 GGGGAGAGCGTCTATGGCGATTTCCAGGAAGCCTTTGATCACCTTTGTAACAAGATCATT       c.840
 G  E  S  V  Y  G  D  F  Q  E  A  F  D  H  L  C  N  K  I  I         p.280

          .         .         .         .         .         .       g.7588
 GCCACCAGGAACCCAGAGGAAATCCGAGGGGGAGGCCTGCTTAAGTACTGCAACCTCTTG       c.900
 A  T  R  N  P  E  E  I  R  G  G  G  L  L  K  Y  C  N  L  L         p.300

          .         .         .         .         .         .       g.7648
 GTGAGGGGCTTTAGGCCCGCCTCTGATGAAATCAAGACCCTTCAAAGGTATATGTGTTCC       c.960
 V  R  G  F  R  P  A  S  D  E  I  K  T  L  Q  R  Y  M  C  S         p.320

          .         .         .         .         .         .       g.7708
 AGGTTTTTCATCGACTTCTCAGACATTGGAGAGCAGCAGAGAAAACTGGAGTCCTATTTG       c.1020
 R  F  F  I  D  F  S  D  I  G  E  Q  Q  R  K  L  E  S  Y  L         p.340

          .         .         .         .         .         .       g.7768
 CAGAACCACTTTGTGGGATTGGAAGACCGCAAGTATGAGTATCTCATGACCCTTCATGGA       c.1080
 Q  N  H  F  V  G  L  E  D  R  K  Y  E  Y  L  M  T  L  H  G         p.360

          .         .         .         .         .         .       g.7828
 GTGGTAAATGAGAGCACAGTGTGCCTGATGGGACATGAAAGAAGACAGACTTTAAACCTT       c.1140
 V  V  N  E  S  T  V  C  L  M  G  H  E  R  R  Q  T  L  N  L         p.380

          .         .         .         .         .         .       g.7888
 ATCACCATGCTGGCTATCCGGGTGTTAGCTGACCAAAATGTCATTCCTAATGTGGCTAAT       c.1200
 I  T  M  L  A  I  R  V  L  A  D  Q  N  V  I  P  N  V  A  N         p.400

          .         .         .         .         .         .       g.7948
 GTCACTTGCTATTACCAGCCAGCCCCCTATGTAGCAGATGCCAACTTTAGCAATTACTAC       c.1260
 V  T  C  Y  Y  Q  P  A  P  Y  V  A  D  A  N  F  S  N  Y  Y         p.420

          .         .         .         .         .         .       g.8008
 ATTGCACAGGTTCAGCCAGTATTCACGTGCCAGCAACAGACCTACTCCACTTGGCTACCC       c.1320
 I  A  Q  V  Q  P  V  F  T  C  Q  Q  Q  T  Y  S  T  W  L  P         p.440

                                                                    g.8017
 TGCAATTAA                                                          c.1329
 C  N  X                                                            p.442

          .         .         .         .         .         .       g.8077
 gaatcatttaaaaatgtcctgtggggaagccatttcagacaagacaggagagaaaaaaaa       c.*60

          .         .         .         .         .         .       g.8137
 aaaaaagaaaaaaaaaagagtgatccagcccttattagggatgtgttttgtgcaatgatg       c.*120

          .         .         .         .         .         .       g.8197
 atatgctcctggttttaagtttggcaaagcttatgtatcttttaatagatgtgggagcat       c.*180

          .         .         .         .         .         .       g.8257
 gatctcgaaaggatccttttcccttctcttattctcctacccaattggattctatcctgc       c.*240

          .         .         .         .         .         .       g.8317
 aaaaaaagagagacctgtcattagaagcaaccaggttctcctgatacaagagaagaaatg       c.*300

          .         .         .         .         .         .       g.8377
 tgtgatgacaatatgggtttgctgtatctgctcccatagctttgccataggaaaaaaaaa       c.*360

          .         .         .         .         .         .       g.8437
 agtggaaagtttcttttaagatggaattcataaaagggaaaatacggaggaaaaaaggtc       c.*420

          .         .         .         .         .         .       g.8497
 tcactccaacttgtgaatcagtttaggagttcagatattaatagtaacaatacaggaaaa       c.*480

          .         .         .         .         .         .       g.8557
 aggggaactccaacgttgggattactgtctgaggcttgtagcaagtgctttctgtggaat       c.*540

          .         .         .         .         .         .       g.8617
 gatcttgttttgctaacaaacggcttgctccaaatgaacagtagtaggttggtgcagttc       c.*600

          .         .         .         .         .         .       g.8677
 tcgtaacaatcagcagaacttatgatgacacaatccattaattccagctgcgtgcataga       c.*660

          .         .         .         .         .         .       g.8737
 tcacatttttaaaatgtaaaaatgcaagcaaaaacagctgtaacaaagaaagtgtgctca       c.*720

          .         .         .         .         .         .       g.8797
 aggaccaaagatttaacagataaaaatacccaattagaagagatatagtagactatatga       c.*780

          .         .         .         .         .         .       g.8857
 agagagattatatttgttacacaccaatatacatcaaagtgcctgttgccttctgaaaat       c.*840

          .         .         .         .         .         .       g.8917
 ttgaagtggcaaaattattttatggtttaatgattattttattttatcagggactgcctc       c.*900

          .         .         .         .         .         .       g.8977
 aagaagaaaataacataagcttgtgaatggtggagaaaatgccctattttttcttgcaaa       c.*960

          .         .         .         .         .         .       g.9037
 tacttgtataaagttaacatttgttgatctgatattatcataggtacatgtgtatgtgtg       c.*1020

          .         .         .         .         .         .       g.9097
 tataaattatatgtgtgtgtgtatatatacattttatatatacattttatatgtatatat       c.*1080

          .         .         .         .         .         .       g.9157
 acacagtagattgactatgatctagaataatgtctcaaataggaaatgtttaaatactgt       c.*1140

          .         .         .         .         .         .       g.9217
 gtgtttttatgttttcaacaggataacatgagacgtgggcatattgcaatgatgaattaa       c.*1200

          .         .         .         .         .         .       g.9277
 atccacatctaaaaaaattaaatgaaggagggaaccaagtaatatatttcataggaagag       c.*1260

          .         .         .         .         .         .       g.9337
 cagaaattatactgttttagtgggatttttttttctttttttttttttctttggtgagcc       c.*1320

          .         .         .         .         .         .       g.9397
 ataaaattccacaaatgggagaatatttgtttggcagagcactcttttttatattgaact       c.*1380

          .         .         .         .         .         .       g.9457
 gccattttgacagttggaacccatttattaaaaaaaaaattgcattcctctatgatgttt       c.*1440

          .         .         .         .         .         .       g.9517
 aatctagtggatcatggatcagtaataggctacttaaatccctgactgctaaaaaggatt       c.*1500

          .         .         .         .         .         .       g.9577
 tccggtgatctaaacactacttgctaatgtttaaatgaattttaatgaatgcattctgca       c.*1560

          .         .         .         .         .         .       g.9637
 tttctggaccactagaatttagtaatgtgaaatgaccctttttacagaatatttgcacaa       c.*1620

          .         .         .         .         .         .       g.9697
 ttgcttaaaatttatatatgagatatatattatatataacattttataaatcatgtcaat       c.*1680

          .         .         .         .         .         .       g.9757
 atgaaacatctttgatctggttgtcacactgcatttaaatatttagtactgtactttaaa       c.*1740

          .         .         .         .         .         .       g.9817
 tcgctttccattaaatcaaatccaactttattttctttcttacaaaaataccagttatac       c.*1800

          .         .         .         .         .         .       g.9877
 ctttgtgaaatgaactggcattactatttcagttcaataacagctaatcctaaaaccacc       c.*1860

          .         .         .         .         .         .       g.9937
 ctttctcctagccagtagttcctctagatactggtctctgaaaatgcatttgttaaaaac       c.*1920

          .         .         .         .         .         .       g.9997
 aaaacaaaactaacacataagaaccttccctttgtgttgtgaaacaaccacataatctcc       c.*1980

          .         .         .         .         .         .       g.10057
 acaaccttagtggatgactgcttgctatgataattcctcgaagacccaattagaagattt       c.*2040

          .         .         .         .         .         .       g.10117
 tcatcatcagttaaagagagaccacgggagaaaaaaatatcctcctgttggcagtataat       c.*2100

          .         .         .         .         .         .       g.10177
 ttgtttgtttgtttatctagggatcctcagatgcttagtgctaggttaatccaggttaat       c.*2160

          .         .         .         .         .         .       g.10237
 ccgtctggactaccttttgtgcatctttctttgaagccttaatgggaacctgatgggttt       c.*2220

          .         .         .         .         .         .       g.10297
 gctgtagcagcttccttgtgaattctgtcagagctgcaacagccgctgcactgccactca       c.*2280

          .         .         .         .         .         .       g.10357
 gttttctaaggaactcctcctactaccatcttggctcagtctccctcacttaagccctgg       c.*2340

          .         .         .         .         .         .       g.10417
 gtttgaaaaattaattgcaacttcccaggaaacattgttcagtttgcagattaagcctgg       c.*2400

          .         .         .         .         .         .       g.10477
 cactcacctatcagaaaccagagctccgcctgcttagttgtttcaaagttttctgaaaga       c.*2460

          .         .         .         .         .         .       g.10537
 aaactaggggagcacttgtgaacacaggagcagctggtgatctgctttcttaccctaact       c.*2520

          .         .         .         .         .         .       g.10597
 cttgacaaatgagtcgtctactattttaaagagtctggaggtctctgactctgccataac       c.*2580

          .         .         .         .         .         .       g.10657
 aataacctgctgttaatttataacacagatttttgtttggaagagccttatttgaaatac       c.*2640

          .         .         .         .         .         .       g.10717
 actttgatttattttcttaaatatttatattcttttcttgcttacttcagggttggtagc       c.*2700

          .         .         .         .         .         .       g.10777
 ttagttggaagtgccagcacctggcacctattcatatagaacaggctgtactcaagacaa       c.*2760

          .         .         .         .         .         .       g.10837
 cttctagcatttactttaagacttatataatttatttctattttgtgtgtactatagtct       c.*2820

          .         .         .         .         .         .       g.10897
 tgtgcatatgtagttgaacacacagtgaaatatatgtctctctttgtggatgtgcggcct       c.*2880

          .         .         .         .         .         .       g.10957
 aaaaatttgaatgtctggtgagagagagccatgtgtataggtcagagaaaagaacagctc       c.*2940

          .         .         .         .         .         .       g.11017
 ccgactccctattagcgcctgtgatttgtttccttttgtgtttatctggcctagtgtgct       c.*3000

          .         .         .         .         .         .       g.11077
 gtttctttaaaccaggaagaagttttgtcttttggaggctcttctcacctgtccagcctg       c.*3060

          .         .         .         .         .         .       g.11137
 gcatgtcagagaacacatagcctgtgacaatgccgtttttaaaggtttacttaatttgca       c.*3120

          .         .         .         .         .         .       g.11197
 gtaaatccagctgcctcaagaactcctacaccaagatggacatttcctttccagaaatgg       c.*3180

          .         .         .         .         .         .       g.11257
 gatcaagtatctgctcactttggtattggatggactaataatgtagctccaaaaatgcaa       c.*3240

          .         .         .         .         .         .       g.11317
 ggatggaagaatatgtgtaatccaaaccaaggaaggaaatgaaaagtgaacgtactgttt       c.*3300

          .         .         .         .         .         .       g.11377
 ttaccacccctttctgtttgcttattgttggttgcttcactgtgcataaagttgttttca       c.*3360

          .         .         .         .         .         .       g.11437
 atgcaacgcttgttaaataaatattgtgaactattttgtaaatgaaatgtattatgttga       c.*3420

          .         .         .         .         .         .       g.11497
 aagctgtcagttcaaaaataagcttttttgttgttgttgaagatgaagtgtgttaggtga       c.*3480

          .         .         .         .         .         .       g.11557
 aaccaaaaagccaaaaaaagtaatttcatatatagcatctatttgaatataatctttctt       c.*3540

          .         .         .         .         .         .       g.11617
 taaaatttcttttagcatagcattttcagtgctaagaaagaatctctatgttatattttg       c.*3600

          .         .         .         .         .         .       g.11677
 ttaaaataatggctttctaacaaagcaaatggtaaagtacaaagttggaagatgtcaagt       c.*3660

          .         .         .         .         .         .       g.11737
 taacgagacttgctgcaaagccttgcagaacggaggaggctctgcctgctggctgtctct       c.*3720

          .         .         .         .         .         .       g.11797
 ccctccaacctctctacaatcatgcctgctttgaggtgttctgttgcagcaagctgcacc       c.*3780

          .         .         .         .         .         .       g.11857
 ttgggtcactcttttggaatattttgactataggctgcgtcacaggcagaaaaggagttg       c.*3840

          .         .         .         .         .         .       g.11917
 atggaaaatggactaaaaaactgacatgtttgaatcagtgctagagggaacagattgtga       c.*3900

          .         .         .         .         .         .       g.11977
 attttgtttacagcatccaatatttggatttttttgtaaataaaaaagttatttttttct       c.*3960

                                                                    g.11982
 attga                                                              c.*3965

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Family with sequence similarity 46 member A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 36
©2004-2018 Leiden University Medical Center