collagen, type I, alpha 1 (COL1A1) - coding DNA reference sequence

(used for mutation description)

(last modified November 12, 2009)


This file was created to facilitate the description of sequence variants in the COL1A1 gene based on a coding DNA reference sequence following the HGVS recommendations.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5006
                                                       tcgtcg       c.-121

 .         .         .         .         .         .                g.5066
 gagcagacgggagtttctcctcggggtcggagcaggaggcacgcggagtgtgaggccacg       c.-61

 .         .         .         .         .         .                g.5126
 catgagcggacgctaaccccctccccagccacaaagagtctacatgtctagggtctagac       c.-1

          .         .         .         .         .         .       g.5186
 ATGTTCAGCTTTGTGGACCTCCGGCTCCTGCTCCTCTTAGCGGCCACCGCCCTCCTGACG       c.60
 M  F  S  F  V  D  L  R  L  L  L  L  L  A  A  T  A  L  L  T         p.20

          .         .         .         .    | 02    .         .    g.6709
 CACGGCCAAGAGGAAGGCCAAGTCGAGGGCCAAGACGAAGACA | TCCCACCAATCACCTGC    c.120
 H  G  Q  E  E  G  Q  V  E  G  Q  D  E  D  I |   P  P  I  T  C      p.40

          .         .         .         .         .         .       g.6769
 GTACAGAACGGCCTCAGGTACCATGACCGAGACGTGTGGAAACCCGAGCCCTGCCGGATC       c.180
 V  Q  N  G  L  R  Y  H  D  R  D  V  W  K  P  E  P  C  R  I         p.60

          .         .         .         .         .         .       g.6829
 TGCGTCTGCGACAACGGCAAGGTGTTGTGCGATGACGTGATCTGTGACGAGACCAAGAAC       c.240
 C  V  C  D  N  G  K  V  L  C  D  D  V  I  C  D  E  T  K  N         p.80

          .         .         .         .         .         | 03    g.7051
 TGCCCCGGCGCCGAAGTCCCCGAGGGCGAGTGCTGTCCCGTCTGCCCCGACGGCTCAG | AG    c.300
 C  P  G  A  E  V  P  E  G  E  C  C  P  V  C  P  D  G  S  E |       p.100

          .         .         .    | 04    .         .         .    g.7213
 TCACCCACCGACCAAGAAACCACCGGCGTCGAG | GGACCCAAGGGAGACACTGGCCCCCGA    c.360
 S  P  T  D  Q  E  T  T  G  V  E   | G  P  K  G  D  T  G  P  R      p.120

           | 05        .         .         .         .         .    g.7363
 GGCCCAAGG | GGACCCGCAGGCCCCCCTGGCCGAGATGGCATCCCTGGACAGCCTGGACTT    c.420
 G  P  R   | G  P  A  G  P  P  G  R  D  G  I  P  G  Q  P  G  L      p.140

          .         .         .         .         .  | 06      .    g.8144
 CCCGGACCCCCCGGACCCCCCGGACCTCCCGGACCCCCTGGCCTCGGAGGA | AACTTTGCT    c.480
 P  G  P  P  G  P  P  G  P  P  G  P  P  G  L  G  G   | N  F  A      p.160

          .         .         .         .         .         .       g.8204
 CCCCAGCTGTCTTATGGCTATGATGAGAAATCAACCGGAGGAATTTCCGTGCCTGGCCCC       c.540
 P  Q  L  S  Y  G  Y  D  E  K  S  T  G  G  I  S  V  P  G  P         p.180

     | 07    .         .         .         .         | 08         . g.8649
 ATG | GGTCCCTCTGGTCCTCGTGGTCTCCCTGGCCCCCCTGGTGCACCT | GGTCCCCAAGGC c.600
 M   | G  P  S  G  P  R  G  L  P  G  P  P  G  A  P   | G  P  Q  G   p.200

          .         .         .         .   | 09     .         .    g.8872
 TTCCAAGGTCCCCCTGGTGAGCCTGGCGAGCCTGGAGCTTCA | GGTCCCATGGGTCCCCGA    c.660
 F  Q  G  P  P  G  E  P  G  E  P  G  A  S   | G  P  M  G  P  R      p.220

          .         .         .       | 10 .         .         .    g.9430
 GGTCCCCCAGGTCCCCCTGGAAAGAATGGAGATGAT | GGGGAAGCTGGAAAACCTGGTCGT    c.720
 G  P  P  G  P  P  G  K  N  G  D  D   | G  E  A  G  K  P  G  R      p.240

          .         .         . | 11       .         .         .    g.9606
 CCTGGTGAGCGTGGGCCTCCTGGGCCTCAG | GGTGCTCGAGGATTGCCCGGAACAGCTGGC    c.780
 P  G  E  R  G  P  P  G  P  Q   | G  A  R  G  L  P  G  T  A  G      p.260

          .         .     | 12   .         .         .         .    g.10005
 CTCCCTGGAATGAAGGGACACAGA | GGTTTCAGTGGTTTGGATGGTGCCAAGGGAGATGCT    c.840
 L  P  G  M  K  G  H  R   | G  F  S  G  L  D  G  A  K  G  D  A      p.280

          .         | 13         .         .         .         .    g.10153
 GGTCCTGCTGGTCCTAAG | GGTGAGCCTGGCAGCCCTGGTGAAAATGGAGCTCCTGGTCAG    c.900
 G  P  A  G  P  K   | G  E  P  G  S  P  G  E  N  G  A  P  G  Q      p.300

     | 14    .         .         .         .         .        | 15. g.10443
 ATG | GGCCCCCGTGGCCTGCCTGGTGAGAGAGGTCGCCCTGGAGCCCCTGGCCCTGCT | GGT c.960
 M   | G  P  R  G  L  P  G  E  R  G  R  P  G  A  P  G  P  A   | G   p.320

          .         .         .         .   | 16     .         .    g.10681
 GCTCGTGGAAATGATGGTGCTACTGGTGCTGCCGGGCCCCCT | GGTCCCACCGGCCCCGCT    c.1020
 A  R  G  N  D  G  A  T  G  A  A  G  P  P   | G  P  T  G  P  A      p.340

          .         .         .       | 17 .         .         .    g.10998
 GGTCCTCCTGGCTTCCCTGGTGCTGTTGGTGCTAAG | GGTGAAGCTGGTCCCCAAGGGCCC    c.1080
 G  P  P  G  F  P  G  A  V  G  A  K   | G  E  A  G  P  Q  G  P      p.360

          .         .         .         .         .         .       g.11058
 CGAGGCTCTGAAGGTCCCCAGGGTGTGCGTGGTGAGCCTGGCCCCCCTGGCCCTGCTGGT       c.1140
 R  G  S  E  G  P  Q  G  V  R  G  E  P  G  P  P  G  P  A  G         p.380

          .      | 18  .         .         .         .         .    g.11206
 GCTGCTGGCCCTGCT | GGAAACCCTGGTGCTGATGGACAGCCTGGTGCTAAAGGTGCCAAT    c.1200
 A  A  G  P  A   | G  N  P  G  A  D  G  Q  P  G  A  K  G  A  N      p.400

  | 19       .         .         .         .         .         .    g.11369
  | GGTGCTCCTGGTATTGCTGGTGCTCCTGGCTTCCCTGGTGCCCGAGGCCCCTCTGGACCC    c.1260
  | G  A  P  G  I  A  G  A  P  G  F  P  G  A  R  G  P  S  G  P      p.420

          .         .         .          | 20        .         .    g.11560
 CAGGGCCCCGGCGGCCCTCCTGGTCCCAAGGGTAACAGC | GGTGAACCTGGTGCTCCTGGC    c.1320
 Q  G  P  G  G  P  P  G  P  K  G  N  S   | G  E  P  G  A  P  G      p.440

          .         .         .    | 21    .         .         .    g.11838
 AGCAAAGGAGACACTGGTGCTAAGGGAGAGCCT | GGCCCTGTTGGTGTTCAAGGACCCCCT    c.1380
 S  K  G  D  T  G  A  K  G  E  P   | G  P  V  G  V  Q  G  P  P      p.460

          .         .         .         .         .         .       g.11898
 GGCCCTGCTGGAGAGGAAGGAAAGCGAGGAGCTCGAGGTGAACCCGGACCCACTGGCCTG       c.1440
 G  P  A  G  E  E  G  K  R  G  A  R  G  E  P  G  P  T  G  L         p.480

          .         .  | 22      .         .         .         .    g.12052
 CCCGGACCCCCTGGCGAGCGT | GGTGGACCTGGTAGCCGTGGTTTCCCTGGCGCAGATGGT    c.1500
 P  G  P  P  G  E  R   | G  G  P  G  S  R  G  F  P  G  A  D  G      p.500

          .      | 23  .         .         .         .         .    g.12237
 GTTGCTGGTCCCAAG | GGTCCCGCTGGTGAACGTGGTTCTCCTGGCCCTGCTGGCCCCAAA    c.1560
 V  A  G  P  K   | G  P  A  G  E  R  G  S  P  G  P  A  G  P  K      p.520

          .         .         .         .         .     | 24   .    g.12462
 GGATCTCCTGGTGAAGCTGGTCGTCCCGGTGAAGCTGGTCTGCCTGGTGCCAAG | GGTCTG    c.1620
 G  S  P  G  E  A  G  R  P  G  E  A  G  L  P  G  A  K   | G  L      p.540

          .         .         .         .         | 25         .    g.12610
 ACTGGAAGCCCTGGCAGCCCTGGTCCTGATGGCAAAACTGGCCCCCCT | GGTCCCGCCGGT    c.1680
 T  G  S  P  G  S  P  G  P  D  G  K  T  G  P  P   | G  P  A  G      p.560

          .         .         .         .         .         .       g.12670
 CAAGATGGTCGCCCCGGACCCCCAGGCCCACCTGGTGCCCGTGGTCAGGCTGGTGTGATG       c.1740
 Q  D  G  R  P  G  P  P  G  P  P  G  A  R  G  Q  A  G  V  M         p.580

          .         .        | 26.         .         .         .    g.13625
 GGATTCCCTGGACCTAAAGGTGCTGCT | GGAGAGCCCGGCAAGGCTGGAGAGCGAGGTGTT    c.1800
 G  F  P  G  P  K  G  A  A   | G  E  P  G  K  A  G  E  R  G  V      p.600

          .         .  | 27      .         .         .         .    g.13828
 CCCGGACCCCCTGGCGCTGTC | GGTCCTGCTGGCAAAGATGGAGAGGCTGGAGCTCAGGGA    c.1860
 P  G  P  P  G  A  V   | G  P  A  G  K  D  G  E  A  G  A  Q  G      p.620

          .      | 28  .         .         .         .         .    g.13991
 CCCCCTGGCCCTGCT | GGTCCCGCTGGCGAGAGAGGTGAACAAGGCCCTGCTGGCTCCCCC    c.1920
 P  P  G  P  A   | G  P  A  G  E  R  G  E  Q  G  P  A  G  S  P      p.640

           | 29        .         .         .         .         .    g.14162
 GGATTCCAG | GGTCTCCCTGGTCCTGCTGGTCCTCCAGGTGAAGCAGGCAAACCTGGTGAA    c.1980
 G  F  Q   | G  L  P  G  P  A  G  P  P  G  E  A  G  K  P  G  E      p.660

     | 30    .         .         .         .         | 31         . g.14765
 CAG | GGTGTTCCTGGAGACCTTGGCGCCCCTGGCCCCTCTGGAGCAAGA | GGCGAGAGAGGT c.2040
 Q   | G  V  P  G  D  L  G  A  P  G  P  S  G  A  R   | G  E  R  G   p.680

          .         .         .         .         .         .       g.14825
 TTCCCTGGCGAGCGTGGTGTGCAAGGTCCCCCTGGTCCTGCTGGTCCCCGAGGGGCCAAC       c.2100
 F  P  G  E  R  G  V  Q  G  P  P  G  P  A  G  P  R  G  A  N         p.700

          .         .        | 32.         .         .         .    g.15182
 GGTGCTCCCGGCAACGATGGTGCTAAG | GGTGATGCTGGTGCCCCTGGAGCTCCCGGTAGC    c.2160
 G  A  P  G  N  D  G  A  K   | G  D  A  G  A  P  G  A  P  G  S      p.720

          .         .         .         .         .         .       g.15242
 CAGGGCGCCCCTGGCCTTCAGGGAATGCCTGGTGAACGTGGTGCAGCTGGTCTTCCAGGG       c.2220
 Q  G  A  P  G  L  Q  G  M  P  G  E  R  G  A  A  G  L  P  G         p.740

          .      | 33/34  .         .         .         .         .    g.15760
 CCTAAGGGTGACAGA | GGTGATGCTGGTCCCAAAGGTGCTGATGGCTCTCCTGGCAAAGAT    c.2280
 P  K  G  D  R   | G  D  A  G  P  K  G  A  D  G  S  P  G  K  D      p.760

          .         .         .         .         .         .       g.15820
 GGCGTCCGTGGTCTGACTGGCCCCATTGGTCCTCCTGGCCCTGCTGGTGCCCCTGGTGAC       c.2340
 G  V  R  G  L  T  G  P  I  G  P  P  G  P  A  G  A  P  G  D         p.780

     | 35    .         .         .         .         .        | 36. g.16262
 AAG | GGTGAAAGTGGTCCCAGCGGCCCTGCTGGTCCCACTGGAGCTCGTGGTGCCCCC | GGA c.2400
 K   | G  E  S  G  P  S  G  P  A  G  P  T  G  A  R  G  A  P   | G   p.800

          .         .         .         .         .  | 37      .    g.16540
 GACCGTGGTGAGCCTGGTCCCCCCGGCCCTGCTGGCTTTGCTGGCCCCCCT | GGTGCTGAC    c.2460
 D  R  G  E  P  G  P  P  G  P  A  G  F  A  G  P  P   | G  A  D      p.820

          .         .         .         .         .         .       g.16600
 GGCCAACCTGGTGCTAAAGGCGAACCTGGTGATGCTGGTGCTAAAGGCGATGCTGGTCCC       c.2520
 G  Q  P  G  A  K  G  E  P  G  D  A  G  A  K  G  D  A  G  P         p.840

          .         .         .          | 38        .         .    g.16748
 CCTGGCCCTGCCGGACCCGCTGGACCCCCTGGCCCCATT | GGTAATGTTGGTGCTCCTGGA    c.2580
 P  G  P  A  G  P  A  G  P  P  G  P  I   | G  N  V  G  A  P  G      p.860

          .         .         .    | 39    .         .         .    g.16934
 GCCAAAGGTGCTCGCGGCAGCGCTGGTCCCCCT | GGTGCTACTGGTTTCCCTGGTGCTGCT    c.2640
 A  K  G  A  R  G  S  A  G  P  P   | G  A  T  G  F  P  G  A  A      p.880

          .         .        | 40.         .         .         .    g.17134
 GGCCGAGTCGGTCCTCCTGGCCCCTCT | GGAAATGCTGGACCCCCTGGCCCTCCTGGTCCT    c.2700
 G  R  V  G  P  P  G  P  S   | G  N  A  G  P  P  G  P  P  G  P      p.900

          .         .         .         .         .         .       g.17194
 GCTGGCAAAGAAGGCGGCAAAGGTCCCCGTGGTGAGACTGGCCCTGCTGGACGTCCTGGT       c.2760
 A  G  K  E  G  G  K  G  P  R  G  E  T  G  P  A  G  R  P  G         p.920

          .         .         .         .         .         .       g.17254
 GAAGTTGGTCCCCCTGGTCCCCCTGGCCCTGCTGGCGAGAAAGGATCCCCTGGTGCTGAT       c.2820
 E  V  G  P  P  G  P  P  G  P  A  G  E  K  G  S  P  G  A  D         p.940

           | 41        .         .         .         .         .    g.17415
 GGTCCTGCT | GGTGCTCCTGGTACTCCCGGGCCTCAAGGTATTGCTGGACAGCGTGGTGTG    c.2880
 G  P  A   | G  A  P  G  T  P  G  P  Q  G  I  A  G  Q  R  G  V      p.960

          .         .         .         .         .        | 42.    g.17632
 GTCGGCCTGCCTGGTCAGAGAGGAGAGAGAGGCTTCCCTGGTCTTCCTGGCCCCTCT | GGT    c.2940
 V  G  L  P  G  Q  R  G  E  R  G  F  P  G  L  P  G  P  S   | G      p.980

          .         .         .         .         .         .       g.17692
 GAACCTGGCAAACAAGGTCCCTCTGGAGCAAGTGGTGAACGTGGTCCCCCTGGTCCCATG       c.3000
 E  P  G  K  Q  G  P  S  G  A  S  G  E  R  G  P  P  G  P  M         p.1000

          .         .         .         .      | 43  .         .    g.17859
 GGCCCCCCTGGATTGGCTGGACCCCCTGGTGAATCTGGACGTGAG | GGGGCTCCTGGTGCC    c.3060
 G  P  P  G  L  A  G  P  P  G  E  S  G  R  E   | G  A  P  G  A      p.1020

          .         .         .          | 44        .         .    g.18023
 GAAGGTTCCCCTGGACGAGACGGTTCTCCTGGCGCCAAG | GGTGACCGTGGTGAGACCGGC    c.3120
 E  G  S  P  G  R  D  G  S  P  G  A  K   | G  D  R  G  E  T  G      p.1040

          .         .         .         .         .         .       g.18083
 CCCGCTGGACCCCCTGGTGCTCCTGGTGCTCCTGGTGCCCCTGGCCCCGTTGGCCCTGCT       c.3180
 P  A  G  P  P  G  A  P  G  A  P  G  A  P  G  P  V  G  P  A         p.1060

          .         .        | 45.         .         .         .    g.18523
 GGCAAGAGTGGTGATCGTGGTGAGACT | GGTCCTGCTGGTCCCGCCGGTCCTGTCGGCCCT    c.3240
 G  K  S  G  D  R  G  E  T   | G  P  A  G  P  A  G  P  V  G  P      p.1080

          .         .  | 46      .         .         .         .    g.18695
 GTTGGCGCCCGTGGCCCCGCC | GGACCCCAAGGCCCCCGTGGTGACAAGGGTGAGACAGGC    c.3300
 V  G  A  R  G  P  A   | G  P  Q  G  P  R  G  D  K  G  E  T  G      p.1100

          .         .         .         .         .         .       g.18755
 GAACAGGGCGACAGAGGCATAAAGGGTCACCGTGGCTTCTCTGGCCTCCAGGGTCCCCCT       c.3360
 E  Q  G  D  R  G  I  K  G  H  R  G  F  S  G  L  Q  G  P  P         p.1120

           | 47        .         .         .         .         .    g.19153
 GGCCCTCCT | GGCTCTCCTGGTGAACAAGGTCCCTCTGGAGCCTCTGGTCCTGCTGGTCCC    c.3420
 G  P  P   | G  S  P  G  E  Q  G  P  S  G  A  S  G  P  A  G  P      p.1140

     | 48    .         .         .         .         .         .    g.19574
 CGA | GGTCCCCCTGGCTCTGCTGGTGCTCCTGGCAAAGATGGACTCAACGGTCTCCCTGGC    c.3480
 R   | G  P  P  G  S  A  G  A  P  G  K  D  G  L  N  G  L  P  G      p.1160

          .         .         .         .         .  | 49      .    g.19726
 CCCATTGGGCCCCCTGGTCCTCGCGGTCGCACTGGTGATGCTGGTCCTGTT | GGTCCCCCC    c.3540
 P  I  G  P  P  G  P  R  G  R  T  G  D  A  G  P  V   | G  P  P      p.1180

          .         .         .         .         .         .       g.19786
 GGCCCTCCTGGACCTCCTGGTCCCCCTGGTCCTCCCAGCGCTGGTTTCGACTTCAGCTTC       c.3600
 G  P  P  G  P  P  G  P  P  G  P  P  S  A  G  F  D  F  S  F         p.1200

          .         .         .         .         .         .       g.19846
 CTGCCCCAGCCACCTCAAGAGAAGGCTCACGATGGTGGCCGCTACTACCGGGCTGATGAT       c.3660
 L  P  Q  P  P  Q  E  K  A  H  D  G  G  R  Y  Y  R  A  D  D         p.1220

          .         .         .         .         .         .       g.19906
 GCCAATGTGGTTCGTGACCGTGACCTCGAGGTGGACACCACCCTCAAGAGCCTGAGCCAG       c.3720
 A  N  V  V  R  D  R  D  L  E  V  D  T  T  L  K  S  L  S  Q         p.1240

          .         .         .         .         .         .       g.19966
 CAGATCGAGAACATCCGGAGCCCAGAGGGCAGCCGCAAGAACCCCGCCCGCACCTGCCGT       c.3780
 Q  I  E  N  I  R  S  P  E  G  S  R  K  N  P  A  R  T  C  R         p.1260

          .         .         .     | 50   .         .         .    g.20158
 GACCTCAAGATGTGCCACTCTGACTGGAAGAGTG | GAGAGTACTGGATTGACCCCAACCAA    c.3840
 D  L  K  M  C  H  S  D  W  K  S  G |   E  Y  W  I  D  P  N  Q      p.1280

          .         .         .         .         .         .       g.20218
 GGCTGCAACCTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTG       c.3900
 G  C  N  L  D  A  I  K  V  F  C  N  M  E  T  G  E  T  C  V         p.1300

          .         .         .         .         .         .       g.20278
 TACCCCACTCAGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGAC       c.3960
 Y  P  T  Q  P  S  V  A  Q  K  N  W  Y  I  S  K  N  P  K  D         p.1320

          .         .         .         .      | 51  .         .    g.20634
 AAGAGGCATGTCTGGTTCGGCGAGAGCATGACCGATGGATTCCAG | TTCGAGTATGGCGGC    c.4020
 K  R  H  V  W  F  G  E  S  M  T  D  G  F  Q   | F  E  Y  G  G      p.1340

          .         .         .         .         .         .       g.20694
 CAGGGCTCCGACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACC       c.4080
 Q  G  S  D  P  A  D  V  A  I  Q  L  T  F  L  R  L  M  S  T         p.1360

          .         .         .         .         .         .       g.20754
 GAGGCCTCCCAGAACATCACCTACCACTGCAAGAACAGCGTGGCCTACATGGACCAGCAG       c.4140
 E  A  S  Q  N  I  T  Y  H  C  K  N  S  V  A  Y  M  D  Q  Q         p.1380

          .         .         .         .         .         .       g.20814
 ACTGGCAACCTCAAGAAGGCCCTGCTCCTCCAGGGCTCCAACGAGATCGAGATCCGCGCC       c.4200
 T  G  N  L  K  K  A  L  L  L  Q  G  S  N  E  I  E  I  R  A         p.1400

          .         .         .         .         | 52         .    g.21003
 GAGGGCAACAGCCGCTTCACCTACAGCGTCACTGTCGATGGCTGCACG | AGTCACACCGGA    c.4260
 E  G  N  S  R  F  T  Y  S  V  T  V  D  G  C  T   | S  H  T  G      p.1420

          .         .         .         .         .         .       g.21063
 GCCTGGGGCAAGACAGTGATTGAATACAAAACCACCAAGACCTCCCGCCTGCCCATCATC       c.4320
 A  W  G  K  T  V  I  E  Y  K  T  T  K  T  S  R  L  P  I  I         p.1440

          .         .         .         .         .         .       g.21123
 GATGTGGCCCCCTTGGACGTTGGTGCCCCAGACCAGGAATTCGGCTTCGACGTTGGCCCT       c.4380
 D  V  A  P  L  D  V  G  A  P  D  Q  E  F  G  F  D  V  G  P         p.1460

          .                                                         g.21138
 GTCTGCTTCCTGTAA                                                    c.4395
 V  C  F  L  X                                                      p.1464

          .         .         .         .         .         .       g.21198
 actccctccatcccaacctggctccctcccacccaaccaactttccccccaacccggaaa       c.*60

          .         .         .         .         .         .       g.21258
 cagacaagcaacccaaactgaaccccctcaaaagccaaaaaatgggagacaatttcacat       c.*120

          .         .         .         .         .         .       g.21318
 ggactttggaaaatatttttttcctttgcattcatctctcaaacttagtttttatctttg       c.*180

          .         .         .         .         .         .       g.21378
 accaaccgaacatgaccaaaaaccaaaagtgcattcaaccttaccaaaaaaaaaaaaaaa       c.*240

          .         .         .         .         .         .       g.21438
 aaaagaataaataaataactttttaaaaaaggaagcttggtccacttgcttgaagaccca       c.*300

          .         .         .         .         .         .       g.21498
 tgcgggggtaagtccctttctgcccgttgggcttatgaaaccccaatgctgccctttctg       c.*360

          .         .         .         .         .         .       g.21558
 ctcctttctccacaccccccttggggcctcccctccactccttcccaaatctgtctcccc       c.*420

          .         .         .         .         .         .       g.21618
 agaagacacaggaaacaatgtattgtctgcccagcaatcaaaggcaatgctcaaacaccc       c.*480

          .         .         .         .         .         .       g.21678
 aagtggcccccaccctcagcccgctcctgcccgcccagcacccccaggccctgggggacc       c.*540

          .         .         .         .         .         .       g.21738
 tggggttctcagactgccaaagaagccttgccatctggcgctcccatggctcttgcaaca       c.*600

          .         .         .         .         .         .       g.21798
 tctccccttcgtttttgagggggtcatgccgggggagccaccagcccctcactgggttcg       c.*660

          .         .         .         .         .         .       g.21858
 gaggagagtcaggaagggccacgacaaagcagaaacatcggatttggggaacgcgtgtca       c.*720

          .         .         .         .         .         .       g.21918
 atcccttgtgccgcagggctgggcgggagagactgttctgttccttgtgtaactgtgttg       c.*780

          .         .         .         .         .         .       g.21978
 ctgaaagactacctcgttcttgtcttgatgtgtcaccggggcaactgcctgggggcgggg       c.*840

          .         .         .         .         .         .       g.22038
 atgggggcagggtggaagcggctccccattttataccaaaggtgctacatctatgtgatg       c.*900

          .         .         .         .         .         .       g.22098
 ggtggggtggggagggaatcactggtgctatagaaattgagatgcccccccaggccagca       c.*960

          .         .         .         .         .         .       g.22158
 aatgttcctttttgttcaaagtctatttttattccttgatatttttcttttttttttttt       c.*1020

          .         .         .         .         .         .       g.22218
 ttttttgtggatggggacttgtgaatttttctaaaggtgctatttaacatgggaggagag       c.*1080

          .         .         .         .         .         .       g.22278
 cgtgtgcggctccagcccagcccgctgctcactttccaccctctctccacctgcctctgg       c.*1140

          .         .         .         .         .         .       g.22338
 cttctcaggcctctgctctccgacctctctcctctgaaaccctcctccacagctgcagcc       c.*1200

          .         .         .         .         .         .       g.22398
 catcctcccggctccctcctagtctgtcctgcgtcctctgtccccgggtttcagagacaa       c.*1260

          .         .         .         .         .         .       g.22458
 cttcccaaagcacaaagcagtttttccccctaggggtgggaggaagcaaaagactctgta       c.*1320

          .         .         .         .         .         .       g.22518
 cctattttgtatgtgtataataatttgagatgtttttaattattttgattgctggaataa       c.*1380

          .         .                                               g.22544
 agcatgtggaaatgacccaaacataa                                         c.*1406

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Collagen, type I, alpha 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVDv.2.0-22 Build 22
©2004-2009 Leiden University Medical Center