bone morphogenetic protein 1 (BMP1) - coding DNA reference sequence

(used for mutation description)

(last modified November 7, 2011)


This file was created to facilitate the description of sequence variants in the BMP1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_029659.1, covering BMP1 transcript NM_006129.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5026
                                   gtcggagggagggagggagggagaga       c.-241

 .         .         .         .         .         .                g.5086
 aagaaagagagaaaaagaaggaaagggagagggagacggctggagcccgaggacgagcgc       c.-181

 .         .         .         .         .         .                g.5146
 ggagccgcggaccgagcggggggcgggagacaggaaggagggaggcgagcagagggaagg       c.-121

 .         .         .         .         .         .                g.5206
 ggaagaggtcggggagcgagggcgggagcggtcgcggtcgcgatcgagcaagcaagcggg       c.-61

 .         .         .         .         .         .                g.5266
 cgagaggacgccctcccctggcctccagtgcgccgcttccctcgccgccgccccgccagc       c.-1

          .         .         .         .         .         .       g.5326
 ATGCCCGGCGTGGCCCGCCTGCCGCTGCTGCTCGGGCTGCTGCTGCTCCCGCGTCCCGGC       c.60
 M  P  G  V  A  R  L  P  L  L  L  G  L  L  L  L  P  R  P  G         p.20

          .         .         .         .         .         .       g.5386
 CGGCCGCTGGACTTGGCCGACTACACCTATGACCTGGCGGAGGAGGACGACTCGGAGCCC       c.120
 R  P  L  D  L  A  D  Y  T  Y  D  L  A  E  E  D  D  S  E  P         p.40

          .         .         | 02         .         .         .    g.13494
 CTCAACTACAAAGACCCCTGCAAGGCGG | CTGCCTTTCTTGGGGACATTGCCCTGGACGAA    c.180
 L  N  Y  K  D  P  C  K  A  A |   A  F  L  G  D  I  A  L  D  E      p.60

          .         .         .         .         .         .       g.13554
 GAGGACCTGAGGGCCTTCCAGGTACAGCAGGCTGTGGATCTCAGACGGCACACAGCTCGT       c.240
 E  D  L  R  A  F  Q  V  Q  Q  A  V  D  L  R  R  H  T  A  R         p.80

          .         .   | 03     .         .         .         .    g.16041
 AAGTCCTCCATCAAAGCTGCAG | TTCCAGGAAACACTTCTACCCCCAGCTGCCAGAGCACC    c.300
 K  S  S  I  K  A  A  V |   P  G  N  T  S  T  P  S  C  Q  S  T      p.100

          .         .         .         .         .         .       g.16101
 AACGGGCAGCCTCAGAGGGGAGCCTGTGGGAGATGGAGAGGTAGATCCCGTAGCCGGCGG       c.360
 N  G  Q  P  Q  R  G  A  C  G  R  W  R  G  R  S  R  S  R  R         p.120

          .         .         .         .         .         .       g.16161
 GCGGCGACGTCCCGACCAGAGCGTGTGTGGCCCGATGGGGTCATCCCCTTTGTCATTGGG       c.420
 A  A  T  S  R  P  E  R  V  W  P  D  G  V  I  P  F  V  I  G         p.140

          .    | 04    .         .         .         .         .    g.16440
 GGAAACTTCACTG | GTAGCCAGAGGGCAGTCTTCCGGCAGGCCATGAGGCACTGGGAGAAG    c.480
 G  N  F  T  G |   S  Q  R  A  V  F  R  Q  A  M  R  H  W  E  K      p.160

          .         .         .         .         .         .       g.16500
 CACACCTGTGTCACCTTCCTGGAGCGCACTGACGAGGACAGCTATATTGTGTTCACCTAT       c.540
 H  T  C  V  T  F  L  E  R  T  D  E  D  S  Y  I  V  F  T  Y         p.180

          .  | 05      .         .         .         .         .    g.16870
 CGACCTTGCGG | GTGCTGCTCCTACGTGGGTCGCCGCGGCGGGGGCCCCCAGGCCATCTCC    c.600
 R  P  C  G  |  C  C  S  Y  V  G  R  R  G  G  G  P  Q  A  I  S      p.200

          .         .         .         .         .         .       g.16930
 ATCGGCAAGAACTGTGACAAGTTCGGCATTGTGGTCCACGAGCTGGGCCACGTCGTCGGC       c.660
 I  G  K  N  C  D  K  F  G  I  V  V  H  E  L  G  H  V  V  G         p.220

          .         .         .         .         .         .       g.16990
 TTCTGGCACGAACACACTCGGCCAGACCGGGACCGCCACGTTTCCATCGTTCGTGAGAAC       c.720
 F  W  H  E  H  T  R  P  D  R  D  R  H  V  S  I  V  R  E  N         p.240

          . | 06       .         .         .         .         .    g.17762
 ATCCAGCCAG | GGCAGGAGTATAACTTCCTGAAGATGGAGCCTCAGGAGGTGGAGTCCCTG    c.780
 I  Q  P  G |   Q  E  Y  N  F  L  K  M  E  P  Q  E  V  E  S  L      p.260

          .         .         .         .         .       | 07 .    g.19569
 GGGGAGACCTATGACTTCGACAGCATCATGCATTACGCTCGGAACACATTCTCCAG | GGGC    c.840
 G  E  T  Y  D  F  D  S  I  M  H  Y  A  R  N  T  F  S  R  |  G      p.280

          .         .         .         .         .         .       g.19629
 ATCTTCCTGGATACCATTGTCCCCAAGTATGAGGTGAACGGGGTGAAACCTCCCATTGGC       c.900
 I  F  L  D  T  I  V  P  K  Y  E  V  N  G  V  K  P  P  I  G         p.300

          .         .         .         .         .         .       g.19689
 CAAAGGACACGGCTCAGCAAGGGGGACATTGCCCAAGCCCGCAAGCTTTACAAGTGCCCA       c.960
 Q  R  T  R  L  S  K  G  D  I  A  Q  A  R  K  L  Y  K  C  P         p.320

   | 08      .         .         .         .         .         .    g.20287
 G | CCTGTGGAGAGACCCTGCAAGACAGCACAGGCAACTTCTCCTCCCCTGAATACCCCAAT    c.1020
 A |   C  G  E  T  L  Q  D  S  T  G  N  F  S  S  P  E  Y  P  N      p.340

          .         .         .         .         .        | 09.    g.31912
 GGCTACTCTGCTCACATGCACTGCGTGTGGCGCATCTCTGTCACACCCGGGGAGAAG | ATC    c.1080
 G  Y  S  A  H  M  H  C  V  W  R  I  S  V  T  P  G  E  K   | I      p.360

          .         .         .         .         .         .       g.31972
 ATCCTGAACTTCACGTCCCTGGACCTGTACCGCAGCCGCCTGTGCTGGTACGACTATGTG       c.1140
 I  L  N  F  T  S  L  D  L  Y  R  S  R  L  C  W  Y  D  Y  V         p.380

          .         .         .         . | 10       .         .    g.33938
 GAGGTCCGAGATGGCTTCTGGAGGAAGGCGCCCCTCCGAG | GCCGCTTCTGCGGGTCCAAA    c.1200
 E  V  R  D  G  F  W  R  K  A  P  L  R  G |   R  F  C  G  S  K      p.400

          .         .         .         .         .         .       g.33998
 CTCCCTGAGCCTATCGTCTCCACTGACAGCCGCCTCTGGGTTGAATTCCGCAGCAGCAGC       c.1260
 L  P  E  P  I  V  S  T  D  S  R  L  W  V  E  F  R  S  S  S         p.420

          .         .         .        | 11.         .         .    g.34328
 AATTGGGTTGGAAAGGGCTTCTTTGCAGTCTACGAAG | CCATCTGCGGGGGTGATGTGAAA    c.1320
 N  W  V  G  K  G  F  F  A  V  Y  E  A |   I  C  G  G  D  V  K      p.440

          .         .         .         .         .         .       g.34388
 AAGGACTATGGCCACATTCAATCGCCCAACTACCCAGACGATTACCGGCCCAGCAAAGTC       c.1380
 K  D  Y  G  H  I  Q  S  P  N  Y  P  D  D  Y  R  P  S  K  V         p.460

          .         .         .         .         .         .       g.34448
 TGCATCTGGCGGATCCAGGTGTCTGAGGGCTTCCACGTGGGCCTCACATTCCAGTCCTTT       c.1440
 C  I  W  R  I  Q  V  S  E  G  F  H  V  G  L  T  F  Q  S  F         p.480

     | 12    .         .         .         .         .         .    g.34641
 GAG | ATTGAGCGCCACGACAGCTGTGCCTACGACTATCTGGAGGTGCGCGACGGGCACAGT    c.1500
 E   | I  E  R  H  D  S  C  A  Y  D  Y  L  E  V  R  D  G  H  S      p.500

          .         .         .         .         .         .       g.34701
 GAGAGCAGCACCCTCATCGGGCGCTACTGTGGCTATGAGAAGCCTGATGACATCAAGAGC       c.1560
 E  S  S  T  L  I  G  R  Y  C  G  Y  E  K  P  D  D  I  K  S         p.520

          .         .         .         .         .         .       g.34761
 ACGTCCAGCCGCCTCTGGCTCAAGTTCGTCTCTGACGGGTCCATTAACAAAGCGGGCTTT       c.1620
 T  S  S  R  L  W  L  K  F  V  S  D  G  S  I  N  K  A  G  F         p.540

          .          | 13        .         .         .         .    g.35363
 GCCGTCAACTTTTTCAAAG | AGGTGGACGAGTGCTCTCGGCCCAACCGCGGGGGCTGTGAG    c.1680
 A  V  N  F  F  K  E |   V  D  E  C  S  R  P  N  R  G  G  C  E      p.560

          .         .         .         .         .         .       g.35423
 CAGCGGTGCCTCAACACCCTGGGCAGCTACAAGTGCAGCTGTGACCCCGGGTACGAGCTG       c.1740
 Q  R  C  L  N  T  L  G  S  Y  K  C  S  C  D  P  G  Y  E  L         p.580

          .         .      | 14  .         .         .         .    g.36575
 GCCCCAGACAAGCGCCGCTGTGAGG | CTGCTTGTGGCGGATTCCTCACCAAGCTCAACGGC    c.1800
 A  P  D  K  R  R  C  E  A |   A  C  G  G  F  L  T  K  L  N  G      p.600

          .         .         .         .         .         .       g.36635
 TCCATCACCAGCCCGGGCTGGCCCAAGGAGTACCCCCCCAACAAGAACTGCATCTGGCAG       c.1860
 S  I  T  S  P  G  W  P  K  E  Y  P  P  N  K  N  C  I  W  Q         p.620

          .         .         .         .         .         .       g.36695
 CTGGTGGCCCCCACCCAGTACCGCATCTCCCTGCAGTTTGACTTCTTTGAGACAGAGGGC       c.1920
 L  V  A  P  T  Q  Y  R  I  S  L  Q  F  D  F  F  E  T  E  G         p.640

        | 15 .         .         .         .         .         .    g.37154
 AATGAT | GTGTGCAAGTACGACTTCGTGGAGGTGCGCAGTGGACTCACAGCTGACTCCAAG    c.1980
 N  D   | V  C  K  Y  D  F  V  E  V  R  S  G  L  T  A  D  S  K      p.660

          .         .         .         .         .         .       g.37214
 CTGCATGGCAAGTTCTGTGGTTCTGAGAAGCCCGAGGTCATCACCTCCCAGTACAACAAC       c.2040
 L  H  G  K  F  C  G  S  E  K  P  E  V  I  T  S  Q  Y  N  N         p.680

          .         .         .         .         .         .       g.37274
 ATGCGCGTGGAGTTCAAGTCCGACAACACCGTGTCCAAAAAGGGCTTCAAGGCCCACTTC       c.2100
 M  R  V  E  F  K  S  D  N  T  V  S  K  K  G  F  K  A  H  F         p.700

         | 16.         .         .         .         .         .    g.41716
 TTCTCAG | ACAAGGACGAGTGCTCCAAGGATAACGGCGGCTGCCAGCAGGACTGCGTCAAC    c.2160
 F  S  D |   K  D  E  C  S  K  D  N  G  G  C  Q  Q  D  C  V  N      p.720

          .         .         .         .         .         .       g.41776
 ACGTTCGGCAGTTATGAGTGCCAATGCCGCAGTGGCTTCGTCCTCCATGACAACAAGCAC       c.2220
 T  F  G  S  Y  E  C  Q  C  R  S  G  F  V  L  H  D  N  K  H         p.740

          .    | 17    .         .         .         .         .    g.46761
 GACTGCAAAGAAG | CCGGCTGTGACCACAAGGTGACATCCACCAGTGGTACCATCACCAGC    c.2280
 D  C  K  E  A |   G  C  D  H  K  V  T  S  T  S  G  T  I  T  S      p.760

          .         .         .         .         .         .       g.46821
 CCCAACTGGCCTGACAAGTATCCCAGCAAGAAGGAGTGCACGTGGGCCATCTCCAGCACC       c.2340
 P  N  W  P  D  K  Y  P  S  K  K  E  C  T  W  A  I  S  S  T         p.780

          .         .  | 18      .         .         .         .    g.47202
 CCCGGGCACCGGGTCAAGCTG | ACCTTCATGGAGATGGACATCGAGTCCCAGCCTGAGTGT    c.2400
 P  G  H  R  V  K  L   | T  F  M  E  M  D  I  E  S  Q  P  E  C      p.800

          .         .         .         .         .         .       g.47262
 GCCTACGACCACCTAGAGGTGTTCGACGGGCGAGACGCCAAGGCCCCCGTCCTCGGCCGC       c.2460
 A  Y  D  H  L  E  V  F  D  G  R  D  A  K  A  P  V  L  G  R         p.820

          .         .         .         .         .         .       g.47322
 TTCTGTGGGAGCAAGAAGCCCGAGCCCGTCCTGGCCACAGGCAGCCGCATGTTCCTGCGC       c.2520
 F  C  G  S  K  K  P  E  P  V  L  A  T  G  S  R  M  F  L  R         p.840

          .         .         .         .         .      | 19  .    g.49310
 TTCTACTCAGATAACTCGGTCCAGCGAAAGGGCTTCCAGGCCTCCCACGCCACAG | AGTGC    c.2580
 F  Y  S  D  N  S  V  Q  R  K  G  F  Q  A  S  H  A  T  E |   C      p.860

          .         .         .         .         .         .       g.49370
 GGGGGCCAGGTACGGGCAGACGTGAAGACCAAGGACCTTTACTCCCACGCCCAGTTTGGC       c.2640
 G  G  Q  V  R  A  D  V  K  T  K  D  L  Y  S  H  A  Q  F  G         p.880

          .         .         .         .         .         .       g.49430
 GACAACAACTACCCTGGGGGTGTGGACTGTGAGTGGGTCATTGTGGCCGAGGAAGGCTAC       c.2700
 D  N  N  Y  P  G  G  V  D  C  E  W  V  I  V  A  E  E  G  Y         p.900

          .         .         .         .         .         .       g.49490
 GGCGTGGAGCTCGTGTTCCAGACCTTTGAGGTGGAGGAGGAGACCGACTGCGGCTATGAC       c.2760
 G  V  E  L  V  F  Q  T  F  E  V  E  E  E  T  D  C  G  Y  D         p.920

          .         .         .         .         .         .       g.49550
 TACATGGAGCTCTTCGACGGCTACGACAGCACAGCCCCCAGGCTGGGGCGCTACTGTGGC       c.2820
 Y  M  E  L  F  D  G  Y  D  S  T  A  P  R  L  G  R  Y  C  G         p.940

        | 20 .         .         .         .         .         .    g.51508
 TCAGGG | CCTCCTGAGGAGGTGTACTCGGCGGGAGATTCTGTCCTGGTGAAGTTCCACTCG    c.2880
 S  G   | P  P  E  E  V  Y  S  A  G  D  S  V  L  V  K  F  H  S      p.960

          .         .         .         .         .         .       g.51568
 GATGACACCATCACCAAAAAAGGTTTCCACCTGCGATACACCAGCACCAAGTTCCAGGAC       c.2940
 D  D  T  I  T  K  K  G  F  H  L  R  Y  T  S  T  K  F  Q  D         p.980

          .         .                                               g.51589
 ACACTCCACAGCAGGAAGTGA                                              c.2961
 T  L  H  S  R  K  X                                                p.986

          .         .         .         .         .         .       g.51649
 ccactgcctgagcaggggcggggactggagcctgctgcccttggtcgcctagactggata       c.*60

          .         .         .         .         .         .       g.51709
 gtgggggtgggcggaaggcaacgcaccatccctctcccccaggccccaggacctgcaggg       c.*120

          .         .         .         .         .         .       g.51769
 ccaatggcctggtgagactgtccataggaggtgggggaactggactccggcataagccac       c.*180

          .         .         .         .         .         .       g.51829
 ttccccacaaacccccaccagcaaggggctggggccagggagcagagcttccacaagaca       c.*240

          .         .         .         .         .         .       g.51889
 tttcgaagtcatcattcctctcttagggggccctgcctggtggcaagagggaatgtcagc       c.*300

          .         .         .         .         .         .       g.51949
 aggaccccatcgccatccctgtgtctctacacgctgtattgtgtatcaccgggggcatta       c.*360

          .         .         .         .         .         .       g.52009
 ttttcattgtaatgttcatttcccacccctgctccagcctcgatttggttttattttgag       c.*420

          .         .         .         .         .         .       g.52069
 cccccattccaccaccccagtttcctggggcacaagtgtctgtgcatgtcccccaggagc       c.*480

          .         .         .         .         .         .       g.52129
 caccgtggggagccgatggggaggggatggagaaacaagacagggcttctctcaggccca       c.*540

          .         .         .         .         .                 g.52187
 gtggccggtcagccacaccagggcaccgcagccaataaaccgaaagtgttacagccaa         c.*598

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Bone morphogenetic protein 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 33
©2004-2011 Leiden University Medical Center